1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AfilCa [17]
3 years ago
5

g A mutation occurs upstream of gene A in the region encoding the ribosome binding site, making it bind more weakly to the ribos

ome. Predict how this mutation will impact the levels of mRNA and protein produced for gene A. Clearly state how mRNA levels will change and how protein levels will change in this mutant relative to wild type bacteria. Restrict your answer to 1-2 sentences.
Biology
1 answer:
Ivanshal [37]3 years ago
4 0

Answer:

it is expected that the mutation results in a reduced initiation of translation and thereby decreasing the level of the protein A, while it does not change the level of mRNA A

Explanation:

Translation in bacteria starts with the formation of the initiation complex which is composed of the small ribosomal subunit, the messenger RNA (mRNA), initiation factors and the initiator transference RNA (tRNA) containing N-formyl-methionine. The small ribosomal subunit binds to a polypurine stretch of variable length in the mRNA called 'the Shine-Dalgarno sequence'. A mutation in this sequence reduces the affinity of the ribosome for the mRNA, thereby, in this case, decreasing the level of protein A. Since transcription occurs before translation, it is expected that this mutation does not change the level of expression of the mRNA A.

You might be interested in
Which of the following planets rotates in a reclining position?
Dennis_Churaev [7]

Answer is Uranus.

in the solar system there are eight planets which rotates about themselves on an axis at a particular angle and revolve around the Sun in an orbit. Venus and Uranus are the two planets which rotate in the clockwise or retrograde direction while all other planets rotate in counterclockwise motion.      

8 0
3 years ago
Read 2 more answers
Meiosis makes four _________ cells.
Svet_ta [14]

Answer: The correct answer is -

B) haploid.

Meiosis is a type of cell division that occurs during the process of formation of gametes particularly sexually reproducing organisms.

Gametes are reproductive, sex cells that are haploid (having half the number of chromosomes as their parent cell).

Thus, during meiosis a diploid parent cell gives 4 haploid daughter cells, called gametes (such as eggs and sperms).

3 0
3 years ago
Read 2 more answers
Ancient astronomers thought that Earth was flat. Which observation eventually proved that this is wrong? A) Earth is at the cent
ivanzaharov [21]
The answer is most likely D. At least I think it is
3 0
3 years ago
Read 2 more answers
What do you call the relationship between oxygen-17 and oxygen-18?
natita [175]
They are different isotopes for oxygen two of te three most stable isotopes ( 16,17,18)
Each different isotope contains different amounts of  Neutrons 
16 contains 8 
17 contains 9  
18 contains 10
In the end the only difference is quantity of neutrons and which is most stable
6 0
3 years ago
If volcanic dust and ash remain in the atmosphere for months or years,what do u predict will happen
SVETLANKA909090 [29]
Very simply, I think that they may block the sun's rays from reaching the Earth, cooling down the planet, or they may eventually end up being turned into acid rain and rain back down to the Earth.
8 0
3 years ago
Other questions:
  • The combination of phosphate, sugar, and nitrogen bases in DNA or RNA
    6·1 answer
  • Scientists rely on ___concepts when researching crop population and medicine
    14·1 answer
  • A respiratory rate of less than ________ and greater than ________ in cases of trauma are criteria for immediate transportation
    13·1 answer
  • Which is a non-Mendelian trait?
    12·2 answers
  • All cells are dependent on what fuel for energy?<br><br> protein<br> glucose<br> DNA<br> ATP
    10·1 answer
  • What is the theory that states organisms best adopted for an environment are more likely to survive and reproduce?​
    15·1 answer
  • The term transgenes refers to
    13·1 answer
  • 2) An object is exerting a force of 1,000 N in a gravity of 20 m/s2 what is
    5·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Which statements are true of receptor-mediated endocytosis?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!