1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elden [556K]
3 years ago
10

Does asthma affect anything else besides just your breathing?

Biology
2 answers:
IrinaVladis [17]3 years ago
8 0

Answer:

The classic symptoms of asthma include wheezing, coughing, tightness in your chest, and feeling short of breath. But other conditions — like allergies, chronic obstructive pulmonary disease (COPD), sleep apnea, and post nasal drip — can trigger the same problems.

Explanation:

lorasvet [3.4K]3 years ago
5 0

Answer:

No.

Explanation:

Pretty much is only with breathing. If a person has asthma, the inside of these airways is irritated and swollen. Asthma can cause shortness of breath, wheezing, coughing, and tightness in the chest. For some people, asthma symptoms only appear when they are exposed to something that irritates their breathing. Others have a kind of asthma that makes breathing difficult all of the time.

You might be interested in
What bond holds water molecules together??
Tasya [4]
Hydrogen bond ! this hold water ( and other molecules with high polarity ) together !
3 0
3 years ago
Whoever can ancer this question in your own words i will give you 5 star and put thanks as in hart you, please I NEED HELP THIS
erastovalidia [21]

Answer:

In case of a physical support there is a bone system involved, in case of the maintenance of the  body weight there is  wide spectrum of thyroid hormones as well as leptin and ghrelin, according to the recent studies.

Explanation:

There is a whole spectrum of physiological  body systems involved in the maintenance of the body weight in humans, as well as metabolism.  One of the most important hormones are thyroid hormones. According to the most recent studies, the major role there is an adequate function of the digestive system as well. The most important digestive-related hormones are leptin and ghrelin.

In case of the physical protection of the human body weight the major role have bones, cartilages and ligaments. All of the aforementioned structures support the human body organs and other structures. In case of skeleton, it has been estimated that it consists of 206 bones. In case of younger individuals, the human skeleton has a greater protective effect to other body systems. In case of bones, its main role is to have a rigid support for internal organs and other body structures. In that way, the body weight is is supported against the force of gravity. Additonaly, it provides a support for muscles to maintene their movements as ligaments bind to the distal and proximal parts of the corresponding bones. If we analyze the upper parts of skeleton, their promienent role is in the lifting and carrieng objects etc. The lower parts of the skeleton are involved in a variety of functions such as walking, runinng, playing sports etc.

In case of internal portions of skeleton, it is necessary to outline the major role of skeleton for example in the abdominal and peritoneal cavities. In these cases, the role of skeleton is to act protectively to the contained organs in those cavities. In case of bones themselves, they act as aa storage site for diverse minerals (calcium, phosphate etc. ). The bone marrow is a storage site for the production of blood components producing cells.

Thyroid hormones have an essential role in the body weight regulation. Their major role is through the regulation of the energy in the human body. Thyroid impairment (such as hyperthyroidism, hypothyroidism) may have a large impact on the changes in the body weight and basal metabolic rate.

The most important thyroid hormones studied in the context of the body weight regulation are free triiodothyronine (T3), free thyroxine (T4), total T3, total T4 and thyroid stimulating hormone (TSH). Thyroid hormones regulate the basal metabolic rate via increasing ATP production and regulation of the Na⁺/K⁺ and Ca₂⁺ concentrations and gradients.

Leptin and ghrelin are hormones that regulate energy balance. Leptin mediates a long-term regulation of energy balance. Leptin suppresses food intake and regulates  energy expenditure.. In that way, leptin leads to weight loss. Leptin is a 6-kDa protein with helical structure, secreted from white adipocytes. The leptin receptors have a role similar to the cytokine receptor I class via transduction mechanisms. Leptin receptors form homodimers. It has been documented that in case of food deprivation, there is a rapid decrease in leptin gene expression. Leptin acts centrally. It inhibits the synthesis and  effect of neuropeptide Y. Such role is the most prominent in the arcuate nucleus of the hypothalamus. There is a lipostatic theory of leptin. Leptin is secreted in the white adipocytes, afterwards secreted into the blood circulation and transported to brain structures. In the brain it inhibits or release the aforementioned factors in order to regulate food intake.

Ghrelin is a fast-acting hormone. It has the role in the meal initiation. It is known that leptin resistant individuals are obese. Ghrelin is a 28-amino acid that stimulates appetite and the release  of growth hormone. Nearly 70 percent of ghrelin is secreted by the stomach and small intestine. Ghrelin has a major role in white adipose tissue where it stimulates adipogenesis, fat storage enzymes and increases trygliceride concentration. It decreases lipolysis.

5 0
3 years ago
the difference between how the lower-level organisms and higher-level organisms (fishes) are counted?
Alexxandr [17]

Answer:

I don't know sorry need kalng points HAHAHAHAHAHA

3 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Explain how humans react and adapt to the limited availability of water<br> NEED ASAP
miss Akunina [59]

Answer:

One of the easiest things people can do when water is scarce is limit its use. for example take shorter showers, water your lawns less

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Genetic drift _____.
    14·2 answers
  • Ashfaq, is asked to explain the difference between a hypothesis theory and a scientific law which are terms used when discussing
    12·1 answer
  • One parent is heterozygous for type B blood. The other parent has type AB blood. Which fraction of their children will
    5·1 answer
  • HURRY PLEASE!!!
    14·1 answer
  • Select all that apply. In gymnosperms, pollination can occur by _____. bees
    6·2 answers
  • One main difference between a pine tree and an arctic fox is..?
    15·2 answers
  • DNA is responsible for making a cell¨s what?
    9·2 answers
  • A student was studying osmosis. She performed an investigation in which she soaked sample cells in a sucrose solution. She weigh
    11·1 answer
  • Some fish in a murky underground lake have lighter scales than the others. This makes it slightly harder for the lighter fish to
    8·1 answer
  • Question 2 of 10
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!