Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
Answer:
they are both sources of energy
Explanation:
Answer:
1. why: to protect the organism against pathogenic infections
2. how: by using genome engineering techniques. For example, by using the CRISPR/Cas9 genome editing system in order to enlarge telomeres and thus avoid the negative effects of aging (i.e., tissue/organ atrophy).
Explanation:
The thymus plays a central role in immunity since in this organ thymus cell lymphocytes (T cells) mature into immunocompetent T-cells that initiate immune responses against pathogenic infections. Moreover, a particular type of B lymphocytes known as thymic B cells also resides at the thymus. It has been proposed that thymic B cells might be involved in the negative selection of T cells. Thus, the thymus plays a critical role in protecting the organism from infections, thereby it would be imperative to avoid thymus atrophy if human life is expanded. Nowadays, we know that telomere length shortens with age, thereby it is expected that genome engineering techniques capable of restoring telomere length might eventually avoid age effects such as, in this case, thymus atrophy. In this regard, the CRISPR-Cas 9 system is a versatile low-cost genome engineering tool that might be used for the addition of nucleotides at telomere ends.
I would answer but it is to blurry can u take another pic
