1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoundrel [369]
3 years ago
14

About artificial selection, determine if YOU think the benefits of artificial selection outweigh the disadvantages.

Biology
1 answer:
Sloan [31]3 years ago
6 0

Answer:

What YOU think

Explanation:

That's what it asks, but here are some points to help you along your way: Artificial selection has brought about the extinction or overpopulation of certain species. This can be seen in the avocado or banana industry. Consumers like the smaller, sweeter species of avocadoes. This caused that species to explode and the old ones to become endangered as farmers grew only that type and bred them selectively. Consumers like the smaller, less mushy, less sweet banana species, so now an amazing species of banana is extinct because the forests that used to have them now no longer exist or were changed to grow only that type of banana. Flip it to the animal side, and it's the same story. Those turkeys that the president "Saves" every year? because of artificial selection, that turkey dies a few weeks later because he grew too plump. Why? Because those turkeys are artificially selected to grow much larger than a normal turkey, and their lifespan is not in mind as they are grown for meat. Also, I hope all of this work gives me brainliest :/

You might be interested in
How does conservation affect biodiversity?
zalisa [80]
Conservation is the protection of an organism or a group of organisms (like an endangered species or forests).

Biodiversity is the numerous amounts of species habitated in our earth. The more biodiversity, the better.

Conservation protects biodiveristy, thus, allowing more species to survive and thrive.
6 0
3 years ago
Read 2 more answers
A woman is sitting on a bench. she is sweating profusely, is short of breath, has numbness in her feet and hands, and feels as t
garik1379 [7]
The answer would be a panic attack.

The panic attack causes the person activates the sympathetic system that them sweating and breathing fast. 
Rapid breathing will cause many CO2 removed than normal, lead to lower level of CO2 in the blood. Carbon dioxide makes the blood more acid, so lower level of CO2 will make the blood become basic, cause respiratory alkalosis which causes the numbness in feet and hands.
3 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
How is the process of cell division in prokaryotes different from cell divition in eukaryotics
denis-greek [22]
Prokaryotes do not contain membrane, and eukaryotes do contain membrane.
5 0
2 years ago
What are the chemical on the left side of a chemical equation call
tester [92]
They are called reactants 
4 0
3 years ago
Other questions:
  • What are the four bases of DNA?
    15·2 answers
  • In the food chain, the grasshopper would be classified as a?
    15·2 answers
  • PLEASE HELP! what are environmental parameters that should be examined before building on land?
    6·1 answer
  • Some activists believe that using animals in scientific experiments is unethical. What is the ethical viewpoint that leads to th
    13·2 answers
  • WILL MARK BRAINLIEST
    15·2 answers
  • Hdhdhdjdhshshdbdhdjdjdjdjdjdjd
    14·1 answer
  • Examples of patterns in nature​
    12·2 answers
  • Count the baby's fingers. His parents both have five fingers on each hand. Six fingers is a dominant trait. Is it possible for t
    11·1 answer
  • An object is propelled along a straight-line path by an external force. If the net force is doubled, its acceleration would ____
    8·1 answer
  • Adhesives used to bond the plies together classifies plywood as either
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!