1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
creativ13 [48]
3 years ago
5

Primary source of energy

Biology
1 answer:
Serga [27]3 years ago
5 0

Answer:

Despite differences in structure and function, all living cells in multicellular organisms have a surrounding cell membrane. Just as the outer layer of your skin separates your body from its environment, the cell membrane (also known as the plasma membrane) separates the inner contents of a cell from its exterior environment. This cell membrane provides a protective barrier around the cell and regulates which materials can pass in or out.

Structure and Composition of the Cell Membrane

The cell membrane is an extremely pliable structure composed primarily of two layers of phospholipids (a “bilayer”). Cholesterol and various proteins are also embedded within the membrane giving the membrane a variety of functions described below.

A single phospholipid molecule has a phosphate group on one end, called the “head,” and two side-by-side chains of fatty acids that make up the lipid “tails” (Figure 3.1.1). The lipid tails of one layer face the lipid tails of the other layer, meeting at the interface of the two layers. The phospholipid heads face outward, one layer exposed to the interior of the cell and one layer exposed to the exterior (Figure 3.1.1).

This diagram shows the structure of a phospholipid. The hydrophilic head group is shown as a pink sphere and the two tails are shown as yellow rectangles. This diagram shows a phospholipid bilayer. Two sets of phospholipids are arranged such that the hydrophobic tails are facing each other and the hydrophilic heads are facing the extracellular environment.

Figure 3.1.1 – Phospholipid Structure and Bilayer: A phospholipid molecule consists of a polar phosphate “head,” which is hydrophilic and a non-polar lipid “tail,” which is hydrophobic. Unsaturated fatty acids result in kinks in the hydrophobic tails. The phospholipid bilayer consists of two adjacent sheets of phospholipids, arranged tail to tail. The hydrophobic tails associate with one another, forming the interior of the membrane. The polar heads contact the fluid inside and outside of the cell.

The phosphate group is negatively charged, making the head polar and hydrophilic—or “water loving.” A hydrophilic molecule (or region of a molecule) is one that is attracted to water. The phosphate heads are thus attracted to the water molecules of both the extracellular and intracellular environments. The lipid tails, on the other hand, are uncharged, or nonpolar, and are hydrophobic—or “water fearing.” A hydrophobic molecule (or region of a molecule) repels and is repelled by water. Phospholipids are thus amphipathic molecules. An amphipathic molecule is one that contains both a hydrophilic and a hydrophobic region. In fact, soap works to remove oil and grease stains because it has amphipathic properties. The hydrophilic portion can dissolve in the wash water while the hydrophobic portion can trap grease in stains that then can be washed away. A similar process occurs in your digestive system when bile salts (made from cholesterol, phospholipids and salt) help to break up ingested lipids.

You might be interested in
The spindle apparatus of animal cells centers on a cell structure called the _____.
Blababa [14]
It is called the Centriole.
6 0
3 years ago
Read 2 more answers
At the end of telophase, what must occur? A) the cytoplasm is divided by cytokinesis B) the new cells must immediately begin to
KatRina [158]
Would it be C for the answer
Plz mark me as a brainiest please
4 0
3 years ago
Read 2 more answers
What happens to a cell in the S phase?
Elodia [21]
It replicates the cell. 
8 0
3 years ago
Read 2 more answers
____ flow is the opposite movement of water against the flow of blood in the fish's gills.
Nikolay [14]
Counter current flow is the opposite movement of water against the flow of blood in the fish's gills.
3 0
4 years ago
In geotropism, plants grow toward _____.<br><br> A)gravity<br> B)sun<br> C)other plants<br> D)light
Annette [7]

Answer:

I think the sun

Explanation:

bc plants need water and sun to survive

8 0
3 years ago
Read 2 more answers
Other questions:
  • The ventral cerebral peduncles are contained in the
    7·1 answer
  • How is the structure, function and position of the crayfish nerve cord different from the rat's spinal cord?
    12·1 answer
  • Which is biotic?<br> water<br> temperature<br> beeswax<br> snow
    5·1 answer
  • 1. Compare and contrast hibernation and migration.
    15·1 answer
  • Which two cell parts are most likely found in both types of cell?
    13·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Ovulation is triggered by a surge of what hormone?
    11·1 answer
  • A chemist reacts 128.95 g of Fe3N2 and 32.34 g of Al as shown below.
    14·1 answer
  • The killifish is described as having tolerance to pollutants, Is this a
    10·1 answer
  • Identify the features of organisms from their different kingdoms ?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!