1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnZ [28]
3 years ago
8

Cuando se introduce material genético directamente en un órgano enfermo con el objetivo de que recobre su función, ¿qué tipo esp

ecífico de terapia se está realizando? A. In vivo. C. In situ. B. Ex vivo. D. Transgénica
Biology
1 answer:
qaws [65]3 years ago
7 0

Answer:

No te compliques, ponle terapia genética.

Explanation:

Es uno de los incisos solo que en diferentes palabras.

Espero y te sirva.

You might be interested in
The embryonic stage is the first phase of the prenatal stage, lasting only two weeks after conception.
Advocard [28]

this statement is False. prenatal development stages in order go from the germinal stage, embryonic stage, and the fetal stage, hope this helps :)

7 0
4 years ago
Read 2 more answers
Charles and Irene are editors at a content development firm. Both of​ them, unknowingly, are working on the same copy of the ann
Keith_Richards [23]

Answer:

lost-update program

Explanation:

Based on the information provided within the question it can be said that this is an example of the database problem known as lost-update program. This term refers to when more than one individual is attempting to update a database entry within the same column and same row, at the same time. This causes the first entry that was saved by the system to be completely overwritten and lost. Such as what happened to Irene's report since it was saved first and then overwritten by Charle's report.

6 0
3 years ago
Which Punnet square represents a cross between two parents that are heterozygous for purple flowers
navik [9.2K]

Answer:

Punnett square is a square diagram which is used to predict the genotype of the offspring produced by particular cross.

Let P and p be the alleles of the gene responsible for the flower colors in a plant.

The genotype of both the parents is given as heterozygous that is, Pp.

Two types of gametes would be formed P and p.

The cross is shown in the image below.

The cross would be result in offspring with three types of genotypes PP, Pp and pp in 1:2:1.


8 0
3 years ago
Read 2 more answers
The green pigment that traps the energy of sunlight for photosynthesis is
nydimaria [60]

Answer:

The green pigment that traps the energy of sunlight for photosynthesis is called chlorophyll.

5 0
3 years ago
Read 2 more answers
Which description best explains the role of DNA in the differentiation of the cells within an organism? A) Each cell has a diffe
professor190 [17]

Answer: Each Cell has the same DNA

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • 15. What process makes bread dough rise?
    15·2 answers
  • What is the benefit of doing group work in class? Are there any drawbacks?
    11·2 answers
  • Which word does not suggest a second appearance? A. disgorge B. efface C. recapitulation D. regurgitate
    5·2 answers
  • The atmosphere is an example of an exchange pool for water
    14·1 answer
  • Jill is 5 years old. She has been diagnosed with ADHD and shows signs of learning disabilities. Her doctor suggests that Jill's
    11·1 answer
  • If your job requires you to use a respirator, your employer is required to do three things. What is missing from the list?
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What organelle in a eukaryotic cell controls photosynthesis?
    15·1 answer
  • 4. Sunlight, water, and carbon dioxide are environmental factors that affect the rate of photosynthesis?
    14·1 answer
  • The peoples of ancient mesopotamia tended to see the world as a hazardous place because:_______
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!