1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataliya [291]
3 years ago
11

Explain the differences in thermal energy and temperature when an

Biology
1 answer:
MrRa [10]3 years ago
8 0

Answer:

solid to liquid is: melting

while liquid to gas: sublimation

You might be interested in
White eye color is an x-linked trait in one line of fruit flies. White eyes is recessive to red eyes. If a red-eyed female and a
Igoryamba
Xw Xw = White eyes female

XW Xw = Red eyes female

XW XW = Red eyes female

XW Y = Red eye male

Xw Y = White eye male

Red eye female = XW Xw or XW XW

White eye male = Xw Y

XW XW mixed Xw Y
100% red eyes (both male and female)

XW Xw mixed Xw Y
Out of girls, 50% red eyes
Out of boys, 50% red eyes
Both genders have a 50% chance of getting white eyes

I hope this helps!
7 0
2 years ago
Are coral snakes venomous?
konstantin123 [22]

Answer: Yes they are highly venomous

Explanation:

4 0
3 years ago
Read 2 more answers
Cell bodies of sensory neurons may be located in ganglia lying outside the central nervous system. Cell bodies of sensory neuron
AlekseyPX

Answer:

True

Explanation:

Sensory neurons are the neurons present in the nerves which can convert the external stimuli into an electrical signal and can transmit the signals from the organs to the central nervous system.

The structure of sensory neuron in pseudounipolar that is at one end it has dendrites and another end transmits the signals to the CNS. The cell bodies  (nucleus) of these sensory neurons are located in the structures called ganglia located outside the CNS.

Thus, True is the correct answer.

7 0
3 years ago
Which two habitats are found at high latitudes?
Rom4ik [11]

Answer:

A) boreal forest and tundra

Explanation:

Boreal forests are present north of 50-60 degree north latitude. Tundra biomes are also called as arctic tundra and are also located in extremes of the north latitude. Boreal forests are world' largest biome and stretches across both North America and Eurasia. So, the two habitats are found at high latitudes among the given options are: boreal forest and tundra.

6 0
4 years ago
Read 2 more answers
Body hair lessened
Ganezh [65]

Answer:

Where's the question?? ;-;

Explanation:

6 0
4 years ago
Read 2 more answers
Other questions:
  • The informal essay is .<br> a. personal and open<br> b. serious and factual
    12·2 answers
  • The Russian chemist Oparin suggested that for organic molecules to form on Earth, the atmosphere was probably rich in all of the
    12·1 answer
  • What is another term that describes genetic materal
    8·1 answer
  • A 25-year-old patient presents with complaints of pain and burning in the vulvar area. upon examination, the nurse practitioner
    6·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • How we use the lever to make work easier? help!
    12·2 answers
  • Which of the 5 options apply to the picture
    12·1 answer
  • What process will the cell use to make viral proteins?
    6·1 answer
  • A rich variety of genetic material in an ecosystem will:
    8·1 answer
  • What percentage of the hydrosphere exists as salt water.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!