1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DerKrebs [107]
3 years ago
14

For separate ecosystems to be classified as the same type of biome they must

Biology
1 answer:
Harlamova29_29 [7]3 years ago
7 0

Answer: It should be <u>C</u>.

Explanation:

For separate ecosystems to be classified as the same type of biome, they must —

 x    have deciduous forests .

 x    be located along the equator .

√  have similar organisms and climates .

 x    be at least one hundred square meters in area.

You might be interested in
Each of the following relates to an aspect of evolution by natural selection. Explain the following. ii. Natural selection and t
dlinn [17]

         The first one, ii. Natural selection and the formation of inseticide resistant insects or antibiotic resistant bacteria.

          This can be explained in very simple way. As we all know, natural selection works in a way that only that adapted living beings are going to survive through a specific environment, whether it's because they can grab their food without too much work, or even that they can adapt to the weather. When we use inseticide, we are killing lots of non-resistant insects, and what's left are those that are resistant to this inseticide, and they'll reproduce again, and again we'll go through the same process, but remember, this insect is now stronger and more resistant that before.

            The second case, iii. speciation and isolation give three examples how it may occur.

            Well. the allopatric speciation and isolation will happen when theres a geographic barrier between one species. This one then is divided into two diffent habitats, but what can divide than could be a mountain, a tree, a river, a rock, anything. And this could be too called as a geographic isolation, because in this new environment, species are going to develop in a different way.

4 0
3 years ago
Rory has been diagnosed with ADHD. He is often impulsive and is prone to emotional outbursts. He has difficulty making plans and
olga nikolaevna [1]

Answer:answerd B

Explanation:

5 0
3 years ago
Why do plant need food
erma4kov [3.2K]

Answer:

They need food in order to gain the initial energy they need.

Explanation:

Plants unlike humans don't get food by primary sources (aka, hunting). instead they retrieve their food from the suns rays. Without the suns rays they are able to convert this energy into glucose for themselves, and will essentially die because they do not have that source of food to give them the energy they need to survive.

8 0
3 years ago
Which word would CHANGE the meaning of the selection above if it replaced "variations"?
timama [110]

Answer:

Explanation:

shifts

6 0
4 years ago
Scientists can produce many plants in the lab by cloning; culturing a few plant cells in a test tube of chemical medium. Few cel
tester [92]

Answer:

in the epicenter

Explanation:

In a Venn Diagram that compares and contrasts the different characteristics or features of the produced plants, "cloning" would be in the epicenter. This is because through the process of "cloning" you are basically copying the core genetic makeup of the plant and creating a brand new plant that shares all of the exact same characteristics and features as the plant's whose genetic makeup was used as a baseline.

7 0
3 years ago
Other questions:
  • Identify the two types of global food webs
    5·1 answer
  • How can a lemon be alkaline if it's full of citric acid?
    8·1 answer
  • Fewer than _____ of blastocysts inserted through ivf successfully implant into the uterus and become newborns.
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A researcher is setting up an experiment to compare the rates of movement of individuals from different light-sensitive single-c
    10·1 answer
  • What Do You Get When You Multiply An Object's mass times the acceleration?
    9·2 answers
  • Order the process of nuclear fusion, beginning with the first step on top and ending with the last step on the bottom. Drag answ
    6·1 answer
  • 1) People occasionally poison themselves with carbon monoxide by building a charcoal fire in an enclosed area. Assuming help arr
    5·1 answer
  • The process by which two species evolve in response to changes in each other over time is called
    10·1 answer
  • URGENT WILL GIVE YOU BRAINLINESS AND 30 POINTS!!
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!