1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrei [34K]
3 years ago
5

Why do you think that parasitism exists, when one of the organisms is harmed by the relationship?

Biology
1 answer:
morpeh [17]3 years ago
4 0
Because although one organism is harmed, the other benefits. So the organism that benefits won't stop the action that is harming the other. Hope that makes sense!
You might be interested in
Descriptions
Arisa [49]
<span>A. The elevated vertical board from which the hoop projects ---------- 9. Backboard
  B. The most basic shot in basketball; uses the backboard ------------- 6. Lay-up
 C. A pass used to cover very long distances ------------------ 5. Overhead pass
D. A pass used for very long distances, but with higher velocity ----- 7. Baseball pass
E. Either of the two goals in basketball --------------10. Basket
F. A common pass that utilizes the floor --------------- 4. Bouncing pass
G. A common pass aimed at the torso of another player ------ 2. Chest pass
H. Term for dribbling the ball from the front to the back of the body --- 3. The spider
I. Repeatedly bouncing the ball on the floor ------- 1. Dribbling
J. A common shot usually taken 5 to 50 feet away from the basket ------ 8. Jump shot</span>
3 0
3 years ago
Read 2 more answers
What characteristics is shared by a hagfish and a lamprey?
garik1379 [7]

Answer:

The correct answer is "a well-developed notochord".

Explanation:

The missing options for this question are:

A) paired fins

B) jaws

C) a well-developed notochord

D) a rasping tongue

The correct answer is option C) "a well-developed notochord".

Lampreys and hagfishes are two species of jawless fish that are uncommon to see, but they have more than 30 different species for each one of them. Both lampreys and hagfishes have a well-developed notochord, during their larvae and adult forms. The notochord provides support to their body as it has the function of a cartilaginous skeleton.

8 0
3 years ago
For a transverse wave, the particles of the medium move ______ to the direction that the wave moves. perpendicular parallel diag
inessss [21]
A transverse wave is when the vibration direction is perpendicular to the motion of the wave. For example, it's like a plucked guitar string. 
8 0
3 years ago
Read 2 more answers
What is the difference between osmosis and diffusion? A) osmosis only occurs in marine (salt water) organisms B) they are the sa
sasho [114]

Answer: The correct answer is: C The are the same except osmosis specifically and only involves water.

Explanation:

Osmosis is the process in which a solvent moves across a semipermeable membrane in order to dilute a concentrated solution and it ends up equalizing the concentration of the solution at both sides of the cell membrane.

On the other hand, diffusion occurs when particles move from an area of higher concentration to an area of lower concentration and it ends up equalizing the concentration.

So the main difference is the presence/ Lack of water in the processes.

In conclusion the correct answer is : C.

7 0
3 years ago
How is the small intestine adapted to its function?
tatuchka [14]

Answer:

The enzymes in the small intestine, help break the food up into smaller particles. Those tiny particles are then absorbed through the thin lining of the intestine into the bloodstream and are carried all where they are needed in the body. Therefore making it adapted to it's function, which is breaking down food including carbohdrates, fats and proteins :>

Explanation:

(*winks and runs of*)

6 0
2 years ago
Other questions:
  • Explain the process of mitosis in a tissue culture for normal cells.
    14·1 answer
  • Ecosystem stability can be a factor of species diversity within a community. Which letter above would indicate the stage of succ
    7·1 answer
  • How are fossil fuels related to climate change?
    8·1 answer
  • Which of the following is a testable hypothesis?
    12·1 answer
  • What happens to crude birth rates when literacy rates go up
    9·2 answers
  • Quais são os tipos de energia utilizados em cidades?
    12·1 answer
  • Calculate the average pulse rate before exercise for this group, to the nearest tenth
    13·2 answers
  • The disappearance of a species from all or some of its geographical range is called _____. A. extinction B. deforestation C. bio
    11·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Which solution is most hypertonic?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!