The discovery of DNA has allowed us to trace ancestors and find out how early humans lived, what they looked like, and who they were.
Answer:
An event can cause changes to occur in one or more of the spheres, and/or an event can be the effect of changes in one or more of Earth's four spheres. This two-way cause and effect relationship between an event and a sphere is called an interaction. Interactions also occur among the spheres.
1. In the heart, an action potential originates in the (E) sinoatrial node.
The cardiac action potential is a term referring to the change in the membrane potential of heart cells causing the heart to contract. Cardiac action potentials are created by a group of specialized cells capable of generating automatic action potentials and are located in the right atrium of the heart. These cells are called sinoatrial node and sometimes are referred to as the natural pacemaker of the heart. This characterization originates from the fact that sinoatrial node continuously provides action potential and sets the rhythm of the heart function.
2. The sequence of travel by an action potential through the heart is (A) sinoatrial node, atrioventricular node, atrioventricular bundle, bundle branches, Purkinje fibers.
As explained above, the cardiac action potential originates from the sinoatrial node. This action potential then travels through the atrioventricular node, which belongs to the electrical conduction system of the heart and is located between the atria and the ventricles. It is responsible for the electrical connection between the right atrium and the right ventricle. The action potential then travels to the atrioventricular bundle (or bundle of His), another part of the electrical conduction system of the heart. The atrioventricular bundle transmits the electrical impulses from the atrioventricular node to the bundle branches. The bundle branches then send the signal to the Purkinje fibers which send the electrical impulses to the ventricles, causing them to contract.
3. The correct answer is A.
The generation of an action potential in the sinoatrial node causes the contraction of the atria. When the action potential passes from the sinoatrial node to the atrioventricular node, it slows down. This causes the transport of the electrical impulse from the atria to the ventricles to slow down. This delay enables the blood (from the contraction of the atria) to fill the ventricles before their contraction.
4. This statement is true.
The interventricular septum is a structure which divides the two ventricles of the heart and it is composed of two branches, the left bundle and the right bundle branch. When the action potential reaches the interventricular septum, it then travels to the apex of the heart from where it travels upwards along the walls of the ventricles and the ventricular contraction begins.
5. This statement is true.
The bundle branches gradually become Purkinje fibers located in the interior of the ventricular walls. Purkinje fibers are specialized cells and are responsible for conducting cardiac action potentials from the bundle branches to the ventricular walls. This signal transduction causes the muscle of the ventricular walls to contract.
Classification of living things takes into consideration of everything, except A. The number of cells the organism is found to have.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
