Answer:
- <u>The hours are the independent variable.</u>
- <u>The wages/wk earned are ( $11/hr )x( hrs worked )
. This is the dependent variable ( depends on hours worked )
.</u>
- <u>The domain is 0 to 30
</u>
- <u>The range is 0 to 330
</u>
Explanation:
<em>The hours are the independent variable and should be plotted on the x-axis
.</em>
<em>The wages/wk earned are ( $11/hr )x( hrs worked )
. This is the dependent variable ( depends on hours worked ) and should be plotted on the y-axis
</em>
<em>---------------
</em>
<em>Let +W+ = wages/wk earned
</em>
<em></em>
<em>Let +h+ = hours/wk worked
</em>
<em>The equation is:
</em>
<em>+W+=+11h+
</em>
<em>The domain is 0 to 30
</em>
<em>( no hrs worked to 30 hrs worked )
</em>
<em>The range is 0 to 330
</em>
<em>( no wages eared to +11%2A30+=+330+ earned )</em>
Photosynthesis, the process which uses light energy to power the combination of carbon dioxide and water to form glucose and oxygen.
B. I'm not sure but they are apart of the <span>Animalia kingdom. </span>
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
I believe the are recently new within the last 50 years i would imagine