Use the diagram to answer the question .

Biology

1 answer:

Firdavs [7]3 years ago

7 0

Explanation:

I need to see the diagram

You might be interested in

juan earn $11 per hour and works at most 30 hours per week. identify the independent and dependent quantity in the situation, an

Vlad [161]

Answer:

The hours are the independent variable.
The wages/wk earned are ( $11/hr )x( hrs worked ) . This is the dependent variable ( depends on hours worked ) .
The domain is 0 to 30
The range is 0 to 330

Explanation:

The hours are the independent variable and should be plotted on the x-axis .

The wages/wk earned are ( $11/hr )x( hrs worked ) . This is the dependent variable ( depends on hours worked ) and should be plotted on the y-axis

---------------

Let +W+ = wages/wk earned

Let +h+ = hours/wk worked

The equation is:

+W+=+11h+

The domain is 0 to 30

( no hrs worked to 30 hrs worked )

The range is 0 to 330

( no wages eared to +11%2A30+=+330+ earned )

7 0

3 years ago

The energy that is used by almost all living things on our planet comes from the sun. it is captured by plants, algae, and some

Klio2033 [76]

Photosynthesis, the process which uses light energy to power the combination of carbon dioxide and water to form glucose and oxygen.

5 0

3 years ago

Flatworms are A.Parasitic B.Free Living C.both A and B D.none of the above

Karolina [17]

B. I'm not sure but they are apart of the Animalia kingdom.

5 0

3 years ago

5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.

dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'

8 0

3 years ago

When did genetically modified foods devlop?

Furkat [3]

I believe the are recently new within the last 50 years i would imagine

6 0

4 years ago