1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vika [28.1K]
3 years ago
10

Why is it helpful that fungi attack and kill other parasitic organisms?

Biology
2 answers:
attashe74 [19]3 years ago
6 0

When killing other parasitic organisms, that parasite is no longer feeding on it's host.

Ostrovityanka [42]3 years ago
5 0

Answer:

it benefits the thing or area it lives on?

You might be interested in
He w does your nervous system work?
UkoKoshka [18]
The nervous system<span> is like a  highway along which </span>your <span>brain sends and receives information about what is happening in the body and around it. This highway is made up of billions of nerve cells, or neurons (say new-rons) which join together to make </span>nerves<span>. A nerve is a fibre that sends impulses through the body.</span>
8 0
3 years ago
Most of the atp supplies for a skeletal muscle undergoing one hour of sustained exercise come from _____.
ioda

The question is incomplete as it does not have the options which are:

A) creatine phosphate.

B) glycolysis.

C) substrate phosphorylation.

D) oxidative phosphorylation.

E) de novo synthesis.

Answer:

D) oxidative phosphorylation.

Explanation:

The ATP is the energy molecule which provides energy to every metabolic process in the organism.

The ATP in humans is produced by a process called cellular respiration where the last phase of the process called electron transport chain produces the highest amount of protein. The electron transport chain is also known as the oxidative phosphorylation as the oxygen is gained and electrons are lost during the phase.

Thus, D) oxidative phosphorylation is correct.

6 0
3 years ago
Need help with 2,3,and 4
liubo4ka [24]
 A C  B 
  THAR U GO    YEEEEEEEEEEEET

Ψδθ

3 0
3 years ago
Read 2 more answers
Explain e.o. wilson’s theory of island biogeography as it applies to environments other than islands physically surrounded by wa
laiz [17]

Today, any environment surrounded by other ecosystems that are unlike it is subject to Wilson’s theory of island biogeography. Because they are geographically isolated from other related ecosystems, these ecologies are referred to as "islands." Waterbodies divide tropical islands, but this idea also takes into account mountaintops, caverns, and other isolated ecosystems.

<h3>What is Wilson’s theory of island biogeography?</h3>
  • The biologist Edward O. Wilson and environmentalist Robert MacArthur published The Theory of Island Biogeography in 1967. It is widely considered as a foundational work in the ecology and biogeography of islands. The book was reissued by the Princeton University Press in 2001 as a volume in their "Princeton Landmarks in Biology" series.
  • The hypothesis that insular biota maintain a dynamic equilibrium between extinction and immigration rates was made more well-known by the book. An island's pace of new species immigration will decline as the number of species increases, while the rate of extinction of native species will rise.
  • Thus, MacArthur and Wilson anticipate that there will come a point of equilibrium where the rate of immigration and the rate of extinction are equal.

To learn more about The Theory of Island Biogeography with the given link

brainly.com/question/17199233

#SPJ4

4 0
1 year ago
Each parent has two of these for a particular gene
Nikolay [14]
They both have two types of DNA for twins
7 0
3 years ago
Other questions:
  • Magnetism refers to
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Where in the cell was the ATP produced?
    14·1 answer
  • One characteristic of living things is their ability to change and adapt over time true or false​
    9·2 answers
  • Controlling voluntary skeletal muscles is a function of the __________ nervous system.
    7·1 answer
  • Some wild animals have unique features, such as stingers, claws, or the ability to change colors. These characteristics are exam
    13·1 answer
  • In which phase of meiosis II does the cytoplasm divide?
    6·1 answer
  • True or False<br> The procedure is the most important part of any scientific method
    11·2 answers
  • which of the following questions will best direct an investigation on how to develop an antibiotic that inhibits protein synthes
    13·1 answer
  • In the process of _________________________________ one sperm fertilizes the egg, and the other fuses with 2 gametophyte nuclei
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!