1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
4 years ago
12

Genetics is the scientific study of heredity? True False

Biology
2 answers:
klemol [59]4 years ago
5 0

Answer:

Scientific Study

Explanation:

Genetics is the study how heritable traits are transmitted from parents to offspring

adelina 88 [10]4 years ago
3 0

Answer:

true

Explanation:

genetics is the study of heredity in organisms and heredity is the process of passing traits from parents to offsprings

You might be interested in
Why does a virus lethal to us not infect animals? I know that RNA viruses mutate at 10,000 to a million times faster than DNA vi
Setler [38]

The virus needs to speak the molecular language of cells. This is how he manages to dominate and enslave them so that they become factories for new viruses, producing the proteins that the infectious agent requires to assemble its descendants. If this conversation is not fine-tuned, even if the virus has the key and enters, it is doomed to failure.

<h3>Why does a virus lethal to us not infect animals?</h3>

For a virus to be able to enter a cell, it must have the right key. And this key, which are the proteins on the surface of viruses, has to enter the correct lock, the receptors that are on the cell membrane. Cells are actually houses with many different doors and locks. Some viruses have keys that open the lock of any cell and any kind of host, and others do not, so the infection caused by viruses is specific.

With this information, we can conclude that some viruses have keys that open the lock of any cell and any kind of host, and others do not, so the infection caused by viruses is specific.

Learn more about virus in brainly.com/question/1427968

#SPJ1

8 0
2 years ago
What would be mostly likely to happen to a plant that had working chloroplasts in its cells but had taken in a poison that kept
rosijanka [135]
Chloroplasts are organelles found in plant cells and eukaryotic algae that conduct photosynthesis. Chloroplasts absorb sunlight and use it in conjunction with water and carbon dioxide gas to produce food for the plant. in this case, a plant might die



7 0
4 years ago
How is cellular respiration the reverse of photosynthesis ?
zheka24 [161]

Answer:

cellular respiration uses the products of photosynthesis as raw materials.

6 0
3 years ago
Read 2 more answers
The sickle cell version of the gene that causes sickle cell disease is recessive. Suppose that two parents with no symptoms have
yKpoI14uk [10]

Answer:

The genes that the child inherited from the parents is the SS gene

Explanation:

The genetic composition of the haemoglobin genotype is given by two gene variants; A which is dominant and S which is recessive. As such, an individual can be AA, AS or SS. Individuals that are AA and AS do not show traits of the disease, but SS individuals have sickle cell anaemia.

From this example, since both parents have no symptoms and their child have sickle cell, their genotypes most likely were AS and AS. Let me show you how:

           A              S

A        AA            AS

S       AS              SS

From the cross above, there is a 1 in 4 chance that if both parents were AS, their child will be SS. Any other composition from the parents will not produce an SS offspring. Hence the genes that the child inherited from the parents is the SS gene.

6 0
3 years ago
Which of the following can best be described as a result of research on gene location and functioning in the human body?
Novosadov [1.4K]

Answer:

The correct answer would be option C.

Study of genes helps in understanding their functioning that is, how they control the traits, how they help in basic physiology of the body, how they are linked to diseases or disorders, and how the genetic disorders can be treated.

Leber Congenital Amaurosis is a genetic disorder which affects the functioning of the eyes.

Thus, gene location and functioning would help in understanding the causes of Leber Congenital Amaurosis disease and in developing the treatment for the same.

6 0
4 years ago
Other questions:
  • According to the results of siegel (1975), decreased pain sensitivity after repeated morphine injections was associated with:
    11·1 answer
  • What are the two different types of assaults? What is the difference between an assault and a homicide?
    5·1 answer
  • What is a natural factor that would immediately likely decrease the ecosystem
    6·1 answer
  • The presence of 10 copies of the c subunit of the F0 complex of yeast ATP synthase allows for the synthesis of 1 ATP for every _
    9·1 answer
  • Topographic map triangles represent
    8·1 answer
  • What studies helped to confirm the existence of sea floor spreading and drifting continents
    7·1 answer
  • (Giving brainliest!!)
    8·1 answer
  • How can the use of fertilizers affect respiratory health?
    12·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What is the average precipitation of a swamp?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!