1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
solmaris [256]
3 years ago
7

You're reading from the journal of a European explorer from the early 1600s. In one passage, the explorer describes sitting on t

he Atlantic Ocean with little wind. He describes the area as being quite far north of the equator and having high pressure.
In which type of global wind was this explorer sailing?
doldrums
horse latitudes
jet stream
polar easterlies
Biology
2 answers:
Delicious77 [7]3 years ago
6 0

Answer:

Option B

Explanation:

Doldrums are located some 5 degrees away from north while horse latitude is located some thirty degrees away from north latitude and by same degrees from the southern hemisphere. Polar eastariles are cold winds blowing across the Polar Regions and jet stream is fast blowing winds.  

Horse latitude is silent winds and the region has high pressure and very little precipitation.  

Hence, option B is correct

Rama09 [41]3 years ago
5 0

Answer:

horse latitudes (B) hope this helps

You might be interested in
Which term defines a well-tested, scientifically supported statement that explains how something works?
Galina-37 [17]
Theory because a theory is a well substantiated explanation of how a particular phenomenon works based on the set of facts which had been repeatedly confirmed through observations and experiments. A scientific theory gives reliable account of a phenomenon.
4 0
3 years ago
Read 2 more answers
What are the precautions that should be token when using a photometer? please help me​
Maksim231197 [3]

Answer:

PRECAUTIONS FOR USING A SPECTROPHOTOMETER :

1 . By allowing the lamps and electronics to warm up

2.By cleaning up any spills inside the cuvette compartment

3.By carrying out the set-up procedure in the correct order

4.By ensuring that %T or transmission is used as appropriate

5.By closing the door to the cuvette compartment before reading the result

6.By performing calibration checks after set up

7.By wiping fingerprints and spilt sample off the outside of the cuvette before measuring

8.By using the correct wavelength

PRECAUTIONS FOR USING A FRAME PHOTOMETER:

1. Do not move or Carry the unit when in use or connected to the mains electricity supply

2. There should be sufficient time for the chimney to cool before handling

3. Do not use acetylene with the flame photometer

4. Over adjustment of the fuel valve will cause excess flame

Do not position the product so that it is difficult to disconnect from the mains supply

5. Do not cover the chimney whilst in use.

6. Do not block or obstruct ventilation slots /airways

7. Do not operate or handle any part of the product with wet hands

I HOPE THIS WILL HELP AND IF NOT LET ME KNOW

8 0
3 years ago
In a certain breed of dogs, brown fur (B) is a dominant trait over yellow fur (b). Gregory owns a brown female. She produced a l
nika2105 [10]
It’s c because one color can get to two different animals
8 0
3 years ago
Read 2 more answers
What is the best definition for the term 'peer review?'
otez555 [7]
A. When you are given of review of how well you by your co workers
8 0
3 years ago
Camouflage helps predators to survive by hiding them from what
Alborosie

Answer:

Organisms use camouflage to mask their location, identity, and movement. This allows prey to avoid predators, and for predators to sneak up on prey. ... The physical characteristics of the organism are important. Animals with fur rely on different camouflage tactics than those with feathers or scales, for instance.

Explanation:

3 0
3 years ago
Other questions:
  • Give 2 negative effects of dumping medical waste
    10·2 answers
  • Two tongue-rollers have 12 children. 8 of their children can roll their tongues and 4 cannot. Make an argument about the genotyp
    8·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What is a dependent variable in biology?
    9·1 answer
  • If the DNA of a representative species from each of the major kingdoms was examined, the sequences coding for which of following
    10·1 answer
  • How could the demise of this seemingly unimportant insect cause severe damage to the rain forest in which it lives?​
    11·1 answer
  • 2. Which of the following is a function of chloroplasts?
    6·1 answer
  • The structure into which the filtrate first passes
    10·1 answer
  • Circle the class type of rock that most likely includes rock layers
    6·2 answers
  • What would be the sequence of<br> nucleotides that pair with gca?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!