1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mixer [17]
2 years ago
15

My eyesight is weak plzz tell me how can i improve?❤ ​

Biology
1 answer:
avanturin [10]2 years ago
7 0

Answer:I will gladly love to help you but what can I improve you with.

Explanation:

You might be interested in
Elephants, who are important grazers, are instrumental in transforming woodlands into grasslands. This has a tremendous impact o
nata0808 [166]
Elephants, who are important grazers, are instrumental in transforming woodlands into grasslands. This has a tremendous impact on other species that depend on the grass for their survival. The significance of the elephant in this example is B. keystone species. 
7 0
2 years ago
Read 2 more answers
What are the two main subdivisions of the nervous system and what areas of the body make up these two subdivisions?
Sav [38]

Answer:

The nervous system is comprised of two major subdivisions, the central nervous system (CNS) and the peripheral nervous system (PNS).

Explanation:

6 0
3 years ago
Eral
EleoNora [17]

Complete question: The chart shows the movement of a ball after several seconds.

Column A is on the x-axis, and Column B is on the y-axis. Which titles should replace A and B?

a. Column A should be “Time,” and Column B should be “Position.”

b. Column A should be “Position,” and Column B should be “Time.”

c. Column A should be “Velocity,” and Column B should be “Speed.”

d. Column A should be “Speed,” and Column B should be “Velocity.”

Answer:

Column A should be "Time," and Column B should be  "Position"

Explanation:

In general, the first column always refers to the x-axis, this is the independent variables. While the second column refers to the y-axis, the dependent variables.

Option A) names Time and Position to the columns. This seems to be correct as time is an independent variable, while the ball position depends on time. The x-axes is named "time", and the Y-axes is named "ball position".

Option B) is not possible because the Position is not the independent variable, and time is not the dependent variable.

Option C) and D) are not possible, as both of them are variables that depend on time.

3 0
2 years ago
The analysis toolpak can be activated through which sequence of steps
k0ka [10]

The analysis ToolPak is an add-in for Microsoft Excel program. The analysis ToolPak contains data analysis tools that can be used for financial, engineering and statistical data evaluation. The analysis Toolpak can be activated through the following sequence of steps;

File-->Options-->Add-ins -->Manage Excel Add-Ins --> Go.

6 0
3 years ago
1. Why is the quadrat method useful for estimating snall populations? Explain why the same method would not be useful for counti
irga5000 [103]

Answer:

Quadrat method is used for estimating the number of individuals in an area. In this method, a large square area on the ground or water surface is marked, call it an enclave. The number of animals present in this enclave is counted. Then by assuming that the animals are less migratory and are uniformly distributed, their number for a large area is estimated by the use of unitary method of calculation. Example a 4 square feet area has 2 snails, then a 1000 square feet area will have (1000 x 2)/4, i.e, 500 snails in it. Fishes can be counted using this method only if they are confined in a small water body like a lake or a pond. Rivers are flowing so the fishes may move along its length which can give us an underestimate or an overestimate of their numbers. Sea has its depth and huge area, and fishes can be moving randomly in it. Hence this method will not work for river and sea fishes.

Explanation:

Hope this helps :D

7 0
2 years ago
Other questions:
  • Diffusion, movement of particles across a membrane is driven by differences in
    13·1 answer
  • Which environmental conditions are most favorable for hurricane formation?
    15·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • _____ better mirrors the mitosis process.<br> Meiosis I<br> Meiosis II
    6·2 answers
  • Which of these is included under land use? Water,rocks,soil,trees,applying pesticides.
    6·2 answers
  • Below, can you use the word CELL in a sentence
    7·2 answers
  • Innate behavior -- a behavior that is present at birth
    13·2 answers
  • What is the complementary strand for the<br> following strand?<br> ATGCCGT
    6·1 answer
  • Each gene controls the production of one or more specific
    6·1 answer
  • How is the blending theory of inheritance useful in genetics?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!