1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adoni [48]
3 years ago
15

How many atoms lined up side by side would equal the thickness of a book page?

Biology
1 answer:
harina [27]3 years ago
3 0
More than 1 million atoms lined up side by side would equal the thickness of a book page. The modern atomic theory was proposed in 1803 by English chemist John Dalton. His premise is based on the fact that all elements are composed of atoms. An atom is defined as the smallest part of an element. It also keeps the identity of the element. Individual atoms are very small. Most elements in their pure form exist as individual atoms. Some elements are made up of groups of atoms. 
You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Help me plzzzzzzzzzzz
matrenka [14]
D. Because an amino acid is a monomer of a protein, meaning when a bunch of them are put together it’s a protein. And so it is when a bunch of monosaccharides are put together, it makes a polysaccharide
3 0
3 years ago
Please me with this question?:))
MariettaO [177]
Just take that photo and go to google home then google lens and press library and put the photo in and it will find something similar.
7 0
3 years ago
Which of the following is NOT associated with a
NikAS [45]

The two diagrams below represent a sugar molecule and a fat molecule 1 point that is used by living organisms. Which statement best describes these two molecules?

3 0
3 years ago
Please help meeeeee
Brums [2.3K]
Sorry i needed the points... good luck tho
7 0
2 years ago
Read 2 more answers
Other questions:
  • Contrast the electrons transport chain in photosynthesis with cellular respiration by identifying the source of the high energy
    11·2 answers
  • One method of bioremediation is using plants to remove arsenic and radioactive uranium from soils.
    7·2 answers
  • THANK U, THANKS! IF YOU ANSWER ILL SAY THANKS!
    6·2 answers
  • Which of these actions should a city with a growing population take to address air pollution?
    15·2 answers
  • What is the difference between an ion and an atom?
    15·2 answers
  • Terri lost her water bottle while hiking in Canada it was a hot day so she drank water from a stream to stay hydrated a few days
    8·1 answer
  • Studies on bee development focused on the Dnmt3 gene. One study switched off the Dnmt3 gene in 100 bee larvae. All the larvae de
    15·1 answer
  • How struggle for existence drove evolution of organism please
    11·1 answer
  • Please help due in 10 minutes!!!
    15·1 answer
  • What is the mass of the green cone on gizmos
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!