1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
garik1379 [7]
3 years ago
7

Early classification systems consisted of two kingdoms; plantae and animalia. what scientific development allowed taxonomists to

establish the monera and protista kingdoms?
Biology
1 answer:
Ulleksa [173]3 years ago
7 0
If you go to book and search you will find your answer
You might be interested in
How are algae cells different from other cells
Arte-miy333 [17]

Answer:

In the case of the algae, each individual cell is responsible for absorbing its own water. This makes the algae nonvascular compared to the highly vascular plant species. In this connection, algae also lack several key structures that are normally present in ordinary plants like the leaves, roots and stem.

6 0
3 years ago
Read 2 more answers
5. Galileo used a(n) that had a lens to bend light.
Kruka [31]

Answer:

v,n v.mnkhj fkhlkfmnj lkmn weol,fgkmj j hwejfq3

Explanation:

kjbdonlfjkh gbfvwef,lknojb gflwj nf

5 0
3 years ago
Read 2 more answers
Gorter and grendel extracted lipids from human red blood cells. they calculated the total surface area for these red blood cells
Anastaziya [24]
<span>The calculated to surface area for red blood cells by Gorter and Grendel found to be 36u2.

 The surface area that would be covered once they spread across the surface of the water is 72u2.

If they spread across the surface area will double. This is because the lipid bilayer with phospholipid the head faces the water on each surface of the membrane.
 It clearly shows that there must be more to membranes than lipid bilayer because membranes grew and the surface tension of membranes is much lower than those of pure lipid structures.</span>
7 0
4 years ago
A channel that opens in response to the binding of a specific molecule, which is usually NOT the solute that passes through the
gogolik [260]

Answer: Ligand gated channel

Explanation:

Ligand gated channel is an essential membrane protein that has pores and allows the passage of specific ions across the plasma membrane when it is activated by a specific chemical . Examples of such ions that pass through Ligand gated channels are Sodium ions, Potassium ions, Calcium ions. Ligand gated channels are found in extensions of the nerve cells.

4 0
4 years ago
Photosynthesis and respiration are alike in that
Natalija [7]
Both photosynthesis and respiration require specific catalyst.
Why not the other answer?
(1) only photosynthesis require the sun as a source of energy,respiration use glucose.
(2) photosynthesis result in the formation of glucose,respiration result in the formation of carbon dioxide.
(3)Only respiration occur in the mitochondria,photosynthesis occur in the stroma of the chloroplast.
Answer is 2 because both of them require specific enzyme and as you know enzymes are biological catalyst. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • The principle of _____ suggests that a gene pair separates during gamete formation?
    11·2 answers
  • What is the difference between a moth and a butterfly?
    5·2 answers
  • What do flowers and runners have in common?
    10·2 answers
  • How would an asthma attack most like affect oxygen delivery in the body
    13·1 answer
  • What substances must pass through a cells membrane for the cell to continue to function?
    7·1 answer
  • Why do you sometimes shiver when your cold?
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • which statement describes the relationship between chromosomes, genes, and alleles? a. alleles move genes to a specific location
    5·1 answer
  • Polypeptides are chains of amino acids linked together in a specific order.
    7·1 answer
  • PLEASE HELPPPPPPPPPPPP
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!