Why are there increasing efforts to reclaim wastewater?

Biology

1 answer:

lyudmila [28]4 years ago

8 0

Treating wastewater is because of (B) they can be used to recharge underground drinking water.

<u>Explanation:</u>

Need for water supplies raised treated wastewater started to be observed as a drinking water supply, and the state began on a plan to promote water reuse and improve organizations that would give relevant public wellness and environmental safeguard.

Reuse may involve flooding of gardens and farming areas or providing cover water and under groundwater (i.e., under groundwater recharge).

Four general ways to treat wastewater include physical water treatment, biological water treatment, chemical treatment, and refuse treatment.

You might be interested in

46.6% Oxygen (O)

goldenfox [79]

A im guessing? soz if i get it wrong.

3 0

4 years ago

Why does lack of oxygen result in the halt of atp synthesis??

dsp73

Because the chain will begin to shut down and will no longer pump [H+] (hydrogen ions) across the membrane; thus, the proton gradient can not be maintained.

:) I hope this answers your question!

6 0

4 years ago

Does anybody know this?

marishachu [46]

We can’t see what you’re talking about :( there’s no image or anything on my end

3 0

3 years ago

Read 2 more answers

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer

quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

5 0

3 years ago

1- In a species of mice, brown fur color is dominant to white fur color. When a brown mouse is crossed with a white mouse all of

yan [13]

The offspring did not have white fur due to the fact that white fur is a recessive trait. One parent had brown fur, which is a dominant trait, that cancels out the recessive trait and that is why the offspring did not have white fur.

4 0

3 years ago