1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
6

How has the poison changed the concentration of pyruvate, NADH and intermembrane H in Jared's cells?

Biology
1 answer:
solong [7]3 years ago
6 0

Answer:

pyruvate - stays the same

NADH increase

intermembrane H+ - decrease

Explanation:

You might be interested in
After each step in a dichotomous key the steps get ____?
Nadusha1986 [10]
The steps get More specific
8 0
3 years ago
Read 2 more answers
What class of elemints include all of the elemnts that are gasses at room tempeture?
Kruka [31]
Non-metals are gassed at room temperature
7 0
3 years ago
Read 2 more answers
A dominant mutation in Drosophila called Delta causes changes in wing morphology in Delta/+ heterozygots. Homozygosity for this
strojnjashka [21]
I don't know I just want
6 0
3 years ago
Of the following experimental results, which is the best evidence that photosynthesis is more efficient at certain wavelengths o
GarryVolchara [31]

Answer:

The correct answer will be option-C

Explanation:

The plant absorbs the sunlight to perform photosynthesis which helps produce the sugar molecule used by the plants.

The plants absorb maximum sunlight at two wavelengths that are red and blue wavelength by chlorophyll and other pigments. The efficiency of photosynthesis is also measured maximum at these two active wavelengths called action spectrum.

In the given question, since the efficiency of photosynthesis has been discussed which could be measured with the production of oxygen and consumption of carbon dioxide. The experiment performed by the Engelmann showed that aerobic bacteria got concentrated in the blue and red wavelengths as the output of the photosynthesis were observed maximum.

Thus, the selected option is the correct answer.

5 0
3 years ago
The motion of an object is called inertia. What force works against an object in motion, or inertia?
Mademuasel [1]

Answer:

i think it is friction bcs gravity helps an abject move and friction causes it to slow down

Explanation:

5 0
3 years ago
Other questions:
  • When testing for the types of macromolecules that make up different articles of food, there are four tests that are commonly uti
    14·1 answer
  • In which of the following ways is DNA replication similar to transcription?
    5·2 answers
  • A woman gets a report of abnormal cells from a routine pap test. She anxiously says to her spouse, "I have cancer. It probably h
    11·1 answer
  • Alice is examining the transverse section of a stem under the microscope. She observes that the vascular bundles are arranged in
    14·2 answers
  • 5.
    8·1 answer
  • A cell undergoing meiosis has a defect and cannot do crossing over. The cell
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which of the four factors that affect evolution apply to the finches that the Grants studied? Use evidence from your research to
    9·1 answer
  • 1. Herbivores are also called__________consumers.
    15·2 answers
  • Daughter cells produced when cells undergo mitosis are genetically _______, and daughter cells produced when cells undergo meios
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!