1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dexar [7]
3 years ago
5

If you know the answer to this question please help!! ASAP

Biology
2 answers:
Kipish [7]3 years ago
7 0

Answer:

the correct answer is option b, as energy follow in such condition is uni directional

Firlakuza [10]3 years ago
3 0

Answer:

B, energy flows from the grass to the grasshopper to the frog to the python.

You might be interested in
When humans eat sugar, the sugar is broken down and released as?
IceJOKER [234]
The answer is between A and C.
7 0
4 years ago
Read 2 more answers
Which statement is true about DNA replication? (2pts)
Fittoniya [83]
<span>DNA replication involves unzipping the DNA molecule, followed by base pairing, which adds complementary nucleotides, to form two new identical DNA molecules that move to the new cells during cell division.</span>
7 0
3 years ago
Read 2 more answers
What word describes a female human carrying an embryo
34kurt
The answer for your question is preganent
8 0
3 years ago
Read 2 more answers
Can someone please help me I truly do not know
never [62]
1. D i think
2. A. 
3. B
4.C i think
5. A

Hope this helped
3 0
4 years ago
suppose a person has a small intestine that has fewer villi than normal.would the person most likely be overweight or underweigh
LenKa [72]
<span>The person who has a small intestine that has fewer villi than normal would most likely be u</span>nderweight. The villi of the small intestines are the small structures that do the absorbing of the nutrients. Having less of these structures, less nutrients are absorbed and the person is more likely to be malnourished.
3 0
3 years ago
Other questions:
  • The walls of the alveoli are composed of two types of cells. What are these types of cells and their functions?
    10·1 answer
  • What type of investigation to plant height if the amount of available light is reduced due to global dimming
    11·1 answer
  • Choose the sentence that does not describe a structural adaptation. A. An elephant has a long trunk that it uses to reach leaves
    15·2 answers
  • Temperatures sunlight and water are examples of what
    6·1 answer
  • Lyme disease is a bacterial infection transmitted to humans from ticks.
    5·1 answer
  • En que lugar se efectúa la fecundación interna
    9·1 answer
  • Passive transport does not mean that a particle is inactive or not moving. It means the particle can move without requiring what
    9·1 answer
  • What researcher developed the theory of use or disuse, also called the theory of acquired characteristics?
    11·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Tissue specific gene regulation is primarily controlled by
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!