1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sliva [168]
3 years ago
9

4 x 5 + 4-2-2 = N??​

Biology
2 answers:
shepuryov [24]3 years ago
7 0
N = 20
BODMAS
4 x 5 = 20
20 + 4 = 24
24 -2 = 22
22 -2 = 20
lozanna [386]3 years ago
4 0

Answer:

4 \:  \times 5 = 20 \\ 20 + 4= 24 \\ 24 - 22 \\ 22 - 2 = 20

20 is the right answer

You might be interested in
What does occean salinaty refer to
alukav5142 [94]

Answer:

sea

Explanation:

≈≈≈≈≈≈≈≈

6 0
3 years ago
Compare and contrast the elevated temperature of someone who is exercising vigorously and someone who has an infection.
Fudgin [204]

Answer: seen below

Explanation:

In vigorous exercise, your brain and body do everything they can to cool you off by increase the flow of blood to the skin where it can cool down with the aid of sweating , while in someone who has an infection they push the temperature inside your body to extreme levels by strengthening your immune system resistance to the infection, the immune system deliberately raises your body temperature as part of its strategy to kill the infection attacking you.

6 0
3 years ago
Jelaskan kesan pengglasieran terhadap bumi​
lesantik [10]
Dendjshzb lol....hahah
6 0
3 years ago
The primary stimulus for release of adrenal medullary hormones comes from Select one: a. the kidneys. b. aldosterone. c. the ant
Natasha_Volkova [10]

Answer:

Correct answer is ''e'' the sympatetic nervows system

Explanation:

THE ENDOCRINE SYSTEM How does the endocrine orchestra work? 1- Nervous Stimuli to the Hypothalamus  production of releasing (stimulatory) or inhibitory hormones, transported via a portal system of vessels to the anterior pituitary gland 2- Anterior Pituitary Gland  pituitary trophic hormones 3- Pituitary trophic hormones stimulate Peripheral Endocrine Glands  production of peripheral hormones 4- Hormone/Receptor Interactions in target organs  hormone actions 5- Peripheral hormones exert Negative Feedback Mechanisms  supression of hypothalamic & pituitary hormones.

6 0
3 years ago
Read 2 more answers
Staphylococcus aureus is grown in heart-infusion broth at 37°C. If you start exponential phase with 100 cells, and after 90 minu
Nikolay [14]

Answer:

30 minutes

Explanation:

Bacteria reproduce by binary fission, a process by which one parent cell divides to form 2 progeny cells. Because one cell produces 2 progeny cells, bacteria are said to undergo exponential ( logarithmic) growth.

As in the case of staphylococcus aureus, we start with 100 cells ,  and after 90 minutes number becomes 800 that means  , firstly the cells doubled (100 x 2 = 200 ) after 30 minutes. Again after 30 minutes they doubled ( 200 x 2 =400 ) and again after 30 minutes they doubled (400 x 2 = 800). So in 90 minutes 100 cells became 800 cells.

Hence the generation time for S.aureus is 30 minutes.

8 0
3 years ago
Other questions:
  • What are the four classes of connective tissue and their general functions?
    12·1 answer
  • What happens when an oceanic and a continental plate collide?
    13·2 answers
  • What tissue makes up anterior and posterior fontanelles?
    9·1 answer
  • Which of the following would not reduce the carrying capacity of an ecosystem for a particular prey species? a. drought b. fewer
    10·2 answers
  • Explain the reason that many organisms found in the oceanic zone are unique and cannot be found anywhere else. Be sure to includ
    13·1 answer
  • Chymotrypsin is a digestive enzyme that breaks down proteins in the small intestine. A student runs a computer simulation of chy
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What is the similar in meaning of dishonour​
    8·1 answer
  • Can u guys help me answering the following Test Guide and using complete sentences
    6·1 answer
  • describes the study of microbes in their natural habitats and the relationships between the microbes and that habitat.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!