RNA, RNA proteins is what i learned how to do
Answer:
When they grow bigger or there are some differences that haven't been there before? (Ex. Spots, stripes, Longer tusks)
Explanation:
I'm just thinking of this logically ok so don't know if this is correct but hope this helps.
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer: Option D) is where cellular respiration occurs.
Explanation:
The mitochondria of the cell is a double-membraned organelle and serve as a site of respiration in plant and animal cells.
Thus, the generation of energy in form of ATP molecules occur within the inner membrane of the mitochondria.
