1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr_godi [17]
3 years ago
9

Which statement best describes messenger RNA?

Biology
2 answers:
sp2606 [1]3 years ago
7 0

Answer:

The mRNA or the messenger RNA plays an important role in the cells. It is responsible for the transmission of genetic information from the DNA and this is sent to the ribosome and in the ribosome, the amino acid sequence is being specified, thus producing gene expression.

Explanation:

hope this help pls give me brainly

WINSTONCH [101]3 years ago
3 0

Answer:

The MRNA or the messenger RNA plays an important role in the cells. It is responsible for the transmission of genetic information from the DNA and this is sent to the ribosome and in the ribosome, the amino acid sequence is being specified, thus producing gene expression.

Explanation:

You might be interested in
What is land breeze and sea breeze? If you can please do this in your own words.
german

Land breeze blows during the night from land to sea and the land becomes cooler faster than the sea. The air above the sea becomes less dense (i.e. warmer) and rises. The cooler air from the land moves in to take its place. Sea breeze: Sea breeze blows during the day and the land heats up faster than the sea

7 0
2 years ago
What causes the weather conditions using what we learned.
miv72 [106K]

Answer:

The sun's solar radiation and the wind's movements.

Explanation:

The heat from the sun and air movement is responsible for the weather on Earth. All-weather takes place in the lowest layer of the Earth's atmosphere, which is a gaseous layer that surrounds the planet. The heat of the sun causes the air in this layer to warm to various temperatures in different regions.

8 0
2 years ago
What form are the instructions that
cestrela7 [59]

Answer:

D. mRNA

Explanation:

8 0
3 years ago
Read 2 more answers
When a coelom is formed by introducing a gap surrounded by mesodermal cells at the base of the blastula, between the ectoderm an
mariarad [96]
Schizocoelic development

The coelom is a fluid-filled body cavity, where the internal organs are suspended in. It is the cavity between the wall of the body and the digestive tract.

In the schizocoelic development of the embryo, the coelom, called the schizocoel, develops as a split in the mesoderm. The outer layer of the mesoderm attaches with the ectoderm to form a body's musculature, while the inner layer attaches with the endoderm to form the wall of the digestive tract. 

This type of development is commonly found in annelids, arthropods, and mollusks. 

3 0
3 years ago
The rate at which blood flows through the human body changes in response to many factors. Which statement describes one of these
Oksana_A [137]

Answer:

Im waiting on an answer aswell.

Explanation:

3 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What would be considered a disadvantage?
    12·2 answers
  • The germinal period is also known as the period of the ______.
    11·1 answer
  • There are 25 elements found in living things. How many of these elements are found in some organisms but not all?
    8·1 answer
  • Low blood pressure stimulates the release of _____ from the adrenal glands
    6·1 answer
  • What is a stem cell?​
    11·1 answer
  • Scientists studying two adjacent ecosystems observe different varieties of organisms in the two areas. All of the following fact
    9·1 answer
  • Which of the following wrap around neurons and speed up signals
    11·2 answers
  • What are energy-giving nutrients
    11·1 answer
  • Energy is conserved when thermal energy is transferred from your body to a coat.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!