1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ira Lisetskai [31]
3 years ago
14

An object is most likely to become electrically charged by gaining or losing which type of particles?

Biology
2 answers:
sweet-ann [11.9K]3 years ago
8 0

Answer:

loosing electrons

Explanation:

xenn [34]3 years ago
7 0

Answer:

For an object to become charged, it must either gain or lose electrons. Losing electrons results in more positive charge than negative charge, making the object charged positively. Gaining electrons results in more negative charge than positive charge, making the object charged negatively.

You might be interested in
In a single day, two 19 year old women and one 20 year old man sought treatment at a university health clinic, complaining of ac
LuckyWell [14K]

Answer:

delightful garden salad of fresh organic lettuces, sprouts, tomatoes, and cucumbers with zesty raspberry vinaigrette dressing.

Stool MCs is recommended

Salmonella typhi

It appears pink rod. Its a gram negative bacteria

7 0
3 years ago
WILL GIVE BRAINLIEST!!!
brilliants [131]

B. producer because most autotrophs are green plants use light for energy.


6 0
3 years ago
How GMO affect evolution​
N76 [4]
It can affect the environment a little because it is explaining what it can do over the time when the evolution grows

Hope this helps :)
6 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
What is NOT a physical change
natka813 [3]

Answer:

a

Explanation:

7 0
2 years ago
Read 2 more answers
Other questions:
  • Oil, natural gas, and coal are considered to be nonrenewable resources. Why are these fuels considered to be nonrenewable? A) Th
    13·2 answers
  • Kathleen, age 7, holds the small ball in both hands in front of her before swinging forward, then backward, with one hand and ba
    5·2 answers
  • In a person with super male syndrome, the 23rd chromosome pair looks like ________.
    15·1 answer
  • Ocean currents at the surface are influenced by
    9·1 answer
  • A cell that contains 46 chromosomes arranged in 23 pairs undergoes the process of _____ to produce two new cells, each containin
    11·1 answer
  • What are the effects of genetic drift ?
    15·1 answer
  • What is a watershed
    12·1 answer
  • QUESTION: what’s the function shared by roots stems but NOT by leaves 1. Food productions 2. Structural support 3. Reproduction
    13·1 answer
  • Once the DNA strand unwinds and is modified; it sent through the
    7·1 answer
  • The moon itself doesn’t emit any _____ like the sun.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!