1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alchen [17]
3 years ago
8

A gene consists of which of the following?

Biology
1 answer:
nirvana33 [79]3 years ago
3 0

Answer:

answer is part (4)

Explanation:

A sequence of bases on DNA that code for a specific protein

You might be interested in
Which use relies on the property of electrical conductivity?
padilas [110]

Answer:

A. Wires

Explanation:

Electrical conductivity is basically how much electrical current a type of material can carry through it, so in other words it is the rate electric current can pass through it.

As  you know, electrical devices rely on electricity (it's in the name) for it to function. Wires are often used in electrical equipment. Wires help connect devices to power sources. They need to be good electrical conductors in order to deliver electricity to the devices and powering it on.

4 0
3 years ago
Read 2 more answers
C6H12O6 + 6O2 --> 6H2O + 6H2O
aev [14]

Answer:

18

Explanation:

6 in C6H12O6 and 12 (6×2) from O2

Therefore, 12 + 6 = 18

8 0
2 years ago
~MUCH NEEDED HELP ASAP PLS AND TY~
victus00 [196]
Maybe C but not for sure
7 0
3 years ago
Carrying the genetic code and determining an organism's structure and function are the functions of
Tom [10]
DNA carry's the genetic code
8 0
3 years ago
Read 2 more answers
What is biology? what is the scientific method?
Zanzabum

Answer:

Biology is the study of living things.

The scientific method is a method of procedure that has characterized natural science.

Explanation:

3 0
3 years ago
Other questions:
  • in humans, widow peaks are dominant to straight hairlines and freckles are dominant to no freckles. A woman who is homozygous fo
    13·1 answer
  • Why are frogs said to have " two lives"
    12·1 answer
  • What body cavity is the pituitary gland in?
    14·1 answer
  • How many years does an apple tree live useful?
    6·1 answer
  • The various parts of the endomembrane system serve different functions in the cell. In this activity, you will identify the role
    10·1 answer
  • Onvoluta worms hatch in early spring. They crawl about in the mud feeding on algae, which find their way into the skin of the wo
    11·1 answer
  • Where do most photosynthesis take place
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Butterflies taste food by
    7·2 answers
  • PLZZZ HELPP!!!!!!!!!!
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!