1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Citrus2011 [14]
2 years ago
11

Is it legal for someone to be deducted pay for getting hurt on the job?

Law
2 answers:
koban [17]2 years ago
7 0

Answer:

Employers are required to make reasonable accommodations for a disability, unless doing so would cause “undue hardship” for the employer. If you are able to perform the essential functions of your job and your employer lowers your pay, such action could be considered disability discrimination

Explanation:

Umnica [9.8K]2 years ago
4 0

Answer:

Hope this explains

Explanation:

workers' compensation benefits are not taxable. It doesn't matter if they're receiving benefits for a slip and fall accident, muscle strain, back injury, tendinitis or carpal tunnel.

You might be interested in
Logistics ______ is a process whereby productivity and capability are increased through deliberate application of continuous pro
lord [1]

Answer:

Transformation.

Explanation:

Supply chain management can be defined as the effective and efficient management of the flow of goods and services as well as all of the production processes involved in the transformation of raw materials into finished products that meet the insatiable want and need of the consumers. Generally, the supply chain management involves all the activities associated with planning, execution and supply of finished goods and services to the consumers.

The fundamental principle of supply chain management is the complete collaboration between multiple firms. These multiple firms include a company that is saddled with the responsibility of manufacturing producer), a wholesaler, and a retailer who typically sells the products to the customers or consumers.

Basically, these three (3) firms or individuals are required to collaborate with each other so as to meet the needs of the customers in a timely manner or fashion and at a fair price too.

Logistics transformation is a process whereby productivity and capability are increased through deliberate application of continuous process improvement.

5 0
3 years ago
What is your idea for a bill?
ioda
A bill is statement that is yet to be made a law
6 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Force is applied to an object and the object moves a distance in the same direction of
Darina [25.2K]
The answer is to your question is unbalanced
6 0
3 years ago
Which is the right answer?
sergiy2304 [10]

Answer:

Broken furniture I think, not sure

Explanation:

7 0
3 years ago
Other questions:
  • Rural areas have _____ of development.
    6·2 answers
  • Which of the following is one of the exceptions to the general rule that searches must be conducted pursuant to a warrant
    14·1 answer
  • What did Supreme Court decisions incorporating the Bill of Rights mean?
    12·2 answers
  • Find a story in the news in the City of Los Angles that has happened within the last 7 days and in one paragraph answer the foll
    6·1 answer
  • What type of fingerprint is this?
    14·1 answer
  • I saw the mayor give a speech at richmond city hall.
    13·1 answer
  • Taking more medications
    11·2 answers
  • Why is monitoring a major part of the work of the probation and parole officers?
    15·1 answer
  • which of the following is a correct comparison between the united states constitution and the articles of confederation?
    8·1 answer
  • Chính quyền và mỗi công dân cần làm gì để hiến pháp đc tôn trọng nhất
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!