1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VARVARA [1.3K]
3 years ago
13

What does the speed of an object tell you about that object's motion?

Biology
1 answer:
slega [8]3 years ago
4 0

Answer:

i think yes

Explanation:

because wy not

You might be interested in
Which theory is currently accepted as explaining the Moon's creation?
aliya0001 [1]

Explanation:

The giant-impact hypothesis is currently the favored scientific hypothesis for the formation of the Moon. Supporting evidence includes: Earth's spin and the Moon's orbit have similar orientations. Moon samples indicate that the Moon's surface was once molten.

5 0
3 years ago
Pls help bio
kogti [31]
<h2>Cell Cycle </h2>

Explanation:

Eukaryotes grow and divide by cell cycle.

The main parts of a cell cycle are an ordered series of events – Gap 1 or G1 phase, Synthesis or S phase, Gap 2 or G2 phase, and the mitosis or M phases.  

Interphase period (G1, S, G2 phases) - cell grows by size, duplicates its content, replicates its DNA, and finally prepares for mitotic cell division .

Mitosis and cytokinesis - formation of two identical daughter cells

Cell cycle is regulated by regulatory or restrictive checkpoints in the cell cycle which are activated with detection of a defective DNA.

Proliferation of undesired or cells with defective DNA like in case of tumor cells is controlled by the action of suppressing agents like p53 and cyclins.

The tumor suppressor gene protein p53 prohibits division of tumor cells. Cyclins regulate cell cycle by activation of the enzyme cyclin-dependent kinase.

3 0
3 years ago
Explain how the triplet code of dna is transcribed and translated in the synthesis of proteins
timama [110]
Ok this is going to be a long answer lol


Translation is the process by which a protein is synthesized from the information contained in a molecule of messenger RNA (mRNA). During translation, an mRNA sequence is read using the genetic code, which is a set of rules that defines how an mRNA sequence is to be translated into the 20-letter code of amino acids, which are the building blocks of proteins.



During transcription, the DNA of a gene serves as a template for complementary base-pairing, and an enzyme called RNA polymerase II catalyzes the formation of a pre-mRNA molecule, which is then processed to form mature mRNA

I hope this helps :)
4 0
3 years ago
The divider between the two brain hemispheres
irina [24]
The <span>corpus callosum connects the two hemispheres. 
Hope that helped you!</span>
5 0
4 years ago
Read 2 more answers
What is the role of PCR in DNA typing
Roman55 [17]

Answer:

Polymerase chain reaction, or PCR, is a laboratory technique used to make multiple copies of a segment of DNA. PCR is very precise and can be used to amplify, or copy, a specific DNA target from a mixture of DNA molecules.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • Before Starch can enter a cell it must be
    7·2 answers
  • PLZZZ ANSWERRR
    5·1 answer
  • What is the path that a body follows as it travels around another body in space is
    15·1 answer
  • Por que os primeiros seres eram heterotrofos e anaerobios
    15·1 answer
  • An alpha particle is composed of
    11·2 answers
  • A good night's sleep improves recall of the previous day's events by facilitating the transfer of memories from the
    14·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What materials make up the cell membrane
    7·2 answers
  • Which of the following statements is true about the glycocalyx? Check All That Apply
    11·1 answer
  • Using scientific language explain first why the earth goes through seasons (winter, spring, summer, fall) and then explain speci
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!