1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AveGali [126]
3 years ago
13

Denials give the suspect more confidence during an interrogation. a. True b. False

Law
1 answer:
kondaur [170]3 years ago
5 0

Answer:

Only guilty people show signs of nervousness during an interrogation.

Explanation:

:)

You might be interested in
El polietileno ¿Es un recurso energético?
inessss [21]
Polyethylene is used in applications ranging for films, tubes, plastic parts, laminates, etc.
3 0
3 years ago
You may turn right on a red light ONLY if you are in the right-most lane, you're turning into the right-most lane on the cross r
Maru [420]

Answer:

true

Explanation:

unless theres a sign that says no right on red

4 0
3 years ago
The Constitution is influenced by the political principle of “rule of law.”<br> True<br> False
Reil [10]

Answer:

True!

Explanation:

The phrase “the Rule of Law” has to be distinguished from the phrase “a rule of law”. The

latter phrase is used to designate some particular legal rule like the rule against perpetuates.

or the rule that says we have to file our taxes by a certain date.

5 0
3 years ago
5. If you had to reform the system of punishments and corrections, what would you do? Why? Simple answers plz
Vesnalui [34]

Answer:

First let’s start with why prisoners should be punished. If they are given too many luxuries then they won't reflect on what they did wrong and they'll come out of prison as the same person they were when they committed the crime. It is important for prisoners to understand that they're in prison because they committed a crime and are there to reform.

Does rehabilitation help criminals? Rehabilitation programs are not only a humane response to criminal justice, they also help reduce recidivism and lower incarceration costs, thus benefiting offenders themselves and society as a whole.

Explanation:

Prisons are the most unsuccessful institution to carry out their actual purpose of ultimately rehabilitating convicts to eventually become law abiding citizens and productive members of society. 68 percent of prisoners released return to prison for committing a new crime within three years of leaving (US Department of Justice).

“Darkness cannot drive out darkness; only light can do that. Hate cannot drive out hate; only love can do that.”  

                                                                             ~Martin Luther King Jr~

6 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • The marks shown in the land of this bullet are known as striations. These striations are
    11·1 answer
  • Please help word cross puzzle
    13·2 answers
  • How does tension between Congress and the president influence the work of congress?
    14·2 answers
  • The current use of Jails hold those convicted of
    7·1 answer
  • Who is a nationalist
    15·2 answers
  • A _________________ provides judges the ability to decide if a civil trial is unnecessary based on ___________________.
    12·1 answer
  • In present day crime scene documentation,
    8·1 answer
  • Idioms and their meanings
    8·1 answer
  • How is the United States not the original Apartheid state?.
    8·1 answer
  • Research a criminal case that was resolved through plea bargaining, and explain the facts of the case. Weighing the evidence and
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!