1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetoff [14.1K]
3 years ago
11

What is a society that is able to survive and function over a specified time?​

Biology
1 answer:
Tcecarenko [31]3 years ago
6 0

Answer:because time and society are different

Explanation:

You might be interested in
Think about what abiotic factors giraffes and trees both need to survive. The tree and the giraffe are competing over what facto
nikitadnepr [17]
I would say space or at least a place of home
7 0
3 years ago
Describe how a Newton's cradle illustrates the conservation of energy.
yulyashka [42]
D is the correct answer
3 0
3 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
DNA is coiled into chromosomes in a cell’s ???<br> .
kati45 [8]

Yes, It indeed is inside a cell's nuculeus. You are correct

3 0
3 years ago
Read 2 more answers
What are two common uses of fats in the bodies of animals?
andrey2020 [161]
Storing nutrition and keeping warm, A good example would be walruses since they have no fur to keep warm

6 0
3 years ago
Read 2 more answers
Other questions:
  • Deepwater waves occur when the depth is
    8·1 answer
  • All of the following are examples of organic matter soil except
    9·1 answer
  • 2) The ________<br> is also called "the species number".
    15·1 answer
  • Why ribosomes are called protein factory
    7·1 answer
  • Why is our blood system is described as transport highway?
    6·1 answer
  • Describe what happened when mendel crossed purebred tall pea plants with purebred short pea plants.
    15·1 answer
  • Breeders can use a Punnett square, such as the one below, to predict the outcome of a genetic cross.
    11·1 answer
  • How can mutations in populations be benifical for survival of the species?
    11·1 answer
  • Question above in picture
    9·1 answer
  • What impact do you think these missions could have on the future of human exploration and humanity as a whole?​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!