1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STALIN [3.7K]
2 years ago
12

I was wondering what the answer to these problems is?

Mathematics
2 answers:
alina1380 [7]2 years ago
7 0
The first one is 4
Second is 5/9
Third is 1/2
Fourth is 11
andre [41]2 years ago
3 0

Answer:

1. 4

2. 5/9

3. 1/2

4. 11

You might be interested in
La finca de Federico tiene tiene un área de 576 m2, En ella ha sembrado naranja y café, 3/8 de la finca están sembrados de naran
Vanyuwa [196]

Answer:

El área de la finca que está sembrada por café es 360 m².

Step-by-step explanation:

La finca de Federico tiene tiene un área de 576 m². \frac{3}{8} de la finca están sembrados de naranjas. Entonces, el área de la finca que está sembrada por naranjas se calcula mediante:

576 m²* \frac{3}{8} = 216 m²

Sabiendo que el resto de la finca esta sembrada de café, esta área se calcula mediante la diferencia del área total de la finca y el área sembrada por naranjas:

576 m² - 216 m²= 360 m²

<u><em>El área de la finca que está sembrada por café es 360 m².</em></u>

6 0
3 years ago
The pack of 300 markers has a cost of $14.00. What is the UNIT COST for the markers? In other words, how much does each marker c
leva [86]

Answer:

04

Step-by-step explanation:

14/300=0.04

8 0
3 years ago
Read 2 more answers
2 Question
Margarita [4]

Answer:

Net Change in Geno's Field Position = 22 yards

Step-by-step explanation:

Assuming Geno initial position before change is 0

Geno Gained 4 yards three times = 4*3 = 12yards

Geno lose 1 yard twice = 1*(-2) = -2yards

Geno Gained 6 yards twice = 6*2 = 12yards

Net Change in Geno's Field Position = 12 + (-2) + 12 yards

                                                            = 22 yards

4 0
3 years ago
PLEASE HELP URGENT WILL MARK BRAINLIEST
vovikov84 [41]

Answer:b) intersecting

7 0
3 years ago
Find an expression which represents the difference when (2 + 4y) is subtracted
nikklg [1K]

Answer:

Simplifying 6x * 3y * 9x2y4 Reorder the terms for easier multiplication: 6 * 3 * 9x * y * x2y4 ... When you enter an expression into the calculator, the calculator will simplify the ... For addition and subtraction, use the standard + and - symbols respectively.

Step-by-step explanation:

7 0
3 years ago
Other questions:
  • Number 4. List all possible rational zeros of g(x)=2x^3 -6x^2 +x-9
    10·1 answer
  • Will give Brainliest if answer is correct!
    12·1 answer
  • I need help with this one question please hope me! It is an inequality on both sides (solve and graph): -4(2-5)&gt;(-3)2 [as in
    7·1 answer
  • I need the answer and the answers are there
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • A technical machinist is asked to build a cubical steel tank that will hold 410 L of water. Calculate in meters the smallest pos
    7·1 answer
  • PLZ i need a lot of help with this question giving brainliest
    7·1 answer
  • Help this is my last question can somebody plz b help me?
    8·2 answers
  • James is saving 5p and 10p coins. He has 75 coins. The ratio of the 5pto the 10p coins is 1 : 1.5. How much are his coins.
    5·1 answer
  • The data in this table represents a linear function.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!