1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
3 years ago
12

An igneous rock that cools quickly will have what type of crystal size?

Biology
1 answer:
Dima020 [189]3 years ago
8 0
Small im pretty sure
You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
Describe two biologically important features of diffusion
Aleonysh [2.5K]
Diffusion is the process in which movement of molecules take place from their higher concentration to their lower concentration. It is an important biological process in any living organism. Two of these are:
1. It allows the exchange of molecules within the organism and with the environment. For example: gaseous exchange in the alveoli of the lungs.
2. It also regulates water content in the body.
8 0
4 years ago
Why is it important that the phospholipid bilayer be both hydrophobic and hydrophilic?
SpyIntel [72]

Answer:

The answer to your question is:  The second option is correct.

Explanation:

Pospholipid bilayer is a thin lipid layer that protects and isolate the cell from the enviroment, also it controls the the entrance of molecules to the cell  and ejects wastes. So it is extremely important.

it is not important    This could not be the right answer, bilater is very important.

to maintain a proper internal environment  I think this is the right answer because among others, membranes mantain a proper internal environment.

to link cells together This option is incorrect, because membranes do not link   cells.

4 0
4 years ago
How does an increase in cell volume impact the diffusion of materials through the cytoplasm?
Setler [38]
Increasing the cell's volume would reduce the efficiency of the diffusion of materials through the plasma membrane into the cytoplasm of the cell. 

On the other hand, increase the surface area and decreasing the volume oft the cell would increase the rate of diffusion across the plasma membrane.
4 0
3 years ago
Is my cat broken? wont chase laser. I'm a idiot
UkoKoshka [18]
If a cat does not chase a laser, does that really qualify it as a broken cat
8 0
4 years ago
Read 2 more answers
Other questions:
  • One of the functions of the skeleton is to produce blood cells.<br><br> True<br> False
    13·1 answer
  • what resource(s) did you have to replenish in the terrarium? were the resources biotic or abiotic? what would happen if you had
    10·1 answer
  • The energy stored in food molecules in living cells is gradually released in a series of linked chemical reactions called a ____
    15·1 answer
  • In 1668 Francesco Redi did a series of experiments on spontaneous generation. He began by putting similar pieces of meat into ei
    13·1 answer
  • moment magnitude estimates the amount of energy an earthquake releases and is derived from the amount of displacement along​
    6·2 answers
  • Why is photosynthesis referred to as a biochemical pathway?
    13·2 answers
  • What are the 4 most abundant/ important elements for humans?
    13·1 answer
  • Biology fund nutrition
    6·1 answer
  • How did scientists determine that gorillas are closely related to humans?
    14·1 answer
  • In pea plants, tallness (t) is dominant to shortness (t). what are the predicted percentages of the genotypes of the offspring i
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!