1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vedmedyk [2.9K]
3 years ago
8

What is the complimentary strand of DNA for 5'--AGGTCCG--3'?

Biology
1 answer:
skad [1K]3 years ago
6 0

Answer:

here is your answer TCCAGGC hope it helps!

You might be interested in
What has caused most of the mass extinctions on earth?
Leto [7]
Global warming/climate change
5 0
3 years ago
PLEASE HELP!! Will mark brainliest
larisa [96]

Answer:

C.

Explanation:

im not sure if its letter C. hope it helps

6 0
3 years ago
Who developed classification system for living things?
topjm [15]
Carl Linnaeus, a Swedish botanist
3 0
3 years ago
Which of the following invertebrates is most closely related to the vertebrates? Select all that apply.
-BARSIC- [3]

Answer:

I would say chordates. (Not absolutely sure so double check)

Explanation:

Chordates have a dorsal nerve cord, which is super close to a spinal cord. (Which vertebrates have.)

8 0
2 years ago
What is the relationship between respiration and cellular respiration?
Ilia_Sergeevich [38]

respiration is when you breath and cellular respiration involves taking the cells from when you breathe and turning it into chemical energy.

partial blockage can be cause by cancer within the bowel area or inflammation within the bowel area. obstruction blockage is caused by tissue compressed in the gut.

for first aid, you turn the individual on their back and deliver 5 back slaps between their shoulder blades, then do 5 chest thrusts.

4 0
2 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What are the basic building blocks of DNA and RNA?
    15·2 answers
  • What type of virus is HIV?
    12·2 answers
  • How do biological communities get to be the way they are?
    6·2 answers
  • A food chain shows the following sequence: eagles eat wolves; wolves eat rabbits; rabbits eat grass; grass is fueled by sunlight
    12·2 answers
  • The lab setup shows four test tubes. Tube 1 contains water only. Tube 2 contains a live snail. Tube 3 contains a live green wate
    13·1 answer
  • Which of the following describes the structure formed when a probe hybridizes to a gene
    9·2 answers
  • Describe the process that leads to a liner pattern of calderas
    12·1 answer
  • The frequencies of the phenotypes in a population often change after each
    12·1 answer
  • Why is the Calvin cycle also called the light-independent reactions?<br>​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!