1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mkey [24]
3 years ago
13

Why is a single base-pair deletion mutation within a protein-coding sequence more likely to be harmful than a single base-pair c

hange mutation?
Biology
1 answer:
Serggg [28]3 years ago
7 0
A single base-pair deletion would cause a frameshift mutation, disrupting every codon sequence read after it. A single base-pair change, however, only affects one codon. It is therefore less likely to cause harm.
You might be interested in
Hello! I Need help with this. Please Help Make Sure you explain your answer i will be marking brainliest to the first person who
jeka94
D westerlies
Because the west wind of flowing well west
3 0
3 years ago
Read 2 more answers
Please help on questions on my profile
Neporo4naja [7]

Answer:

Okay ill look at them

Explanation:

4 0
3 years ago
Which atomic particles are equal in mass?
BartSMP [9]

Answer:

Protons and neutrons have approximately the same mass, about 1.67 × 10−24 grams, which scientists define as one atomic mass unit (amu) or one Dalton. Each electron has a negative charge (−1) equal to the positive charge of a proton (+1). Neutrons are uncharged particles found within the nucleus. hope this helps you :)

7 0
3 years ago
Help plezz if u can
irinina [24]

Answer:

1. It seeps in the ground and becomes ground water.

2. It falls back down to earth as Rain, Hail and Snow.

3. Water moves through the living organisms in an ecosystem

4. Transportation is the process that moves things like water from one place to another.

Explanation:

I passed Biology last year in 10th so I recalled my biology stuff.

4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • What form of pollution, if any, does each energy source cause?
    13·1 answer
  • Certain bacteria living in a human's large intestine help to produce vitamin K. The bacteria get nutrients from the human. This
    6·1 answer
  • What are 3 things you can determine about different types of paper
    10·1 answer
  • A client who has a history of untreated cervicitis tells the nurse that she is concerned about the risk of experiencing problems
    15·1 answer
  • Which nutrient is changed by bacteria into different forms? A.water B.oxygen C.nitrogen D.carbon
    7·2 answers
  • _____ are located in areas where filtration of larger molecules occurs.
    5·2 answers
  • Why does pollan think that "human choices" are to blame in creating such an oversupply of cheap, processed foods?
    8·1 answer
  • At what stage is the DNA in the nucleus of the cell, loosely coiled?
    6·2 answers
  • Which side of the hill of the topographic map is steeper<br><br> Please help i’ll brainliest
    6·2 answers
  • The cells in a certain part of a plant form tubes. What is the most likely
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!