1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
3 years ago
7

Identify the true statements regarding liver glycogen phosphorylase a. Protein phosphatase 1 is abbreviated PP1. The binding of

glucose to liver phosphorylase a shifts the equilibrium from the active form to the inactive form. Liver phosphorylase a concentration decreases when glucose enters the blood. As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. Liver phosphorylase a is regulated by AMP, adenosine monophosphate. When PP1 is bound to phosphorylase a, both PP1 and phosphorylase a are active.
Biology
1 answer:
katrin2010 [14]3 years ago
5 0

Answer:

Liver phosphorylase a concentration decreases when glucose enters the blood.

The binding of glucose to liver phosphorylase a shifts the equilibrium from the active form

As the concentration of phosphorylase a decreases, the activity of glycogen synthase increases. to the inactive form

Explanation:

Protein phosphatase 1 (PP1) is a phosphatase enzyme known to remove phosphate groups from serine/threonine amino acid residues. PP1 plays diverse biological roles including, among others, cell progression, control of glucose metabolism, muscle contraction, etc. In glucose metabolism, PP1 regulates diverse glycogen metabolizing enzymes (e.g., glycogen synthase, glycogen phosphorylase, etc). In the liver, glycogen phosphorylase catalyzes the rate-limiting step in glycogenolysis by releasing glucose-1-phosphate. Glycogen phosphorylase <em>a</em> is converted (and inactivated) into the <em>b</em> form by PP1, which catalyzes the hydrolysis of the phosphate bond between serine and the phosphoryl group. In the liver, glucose binds in order to inhibit glycogen phosphorylase <em>a</em>, thereby inducing the dissociation and activation of PP1 from glycogen phosphorylase <em>a</em>.  

You might be interested in
What is the most common tree in the taiga?
ad-work [718]

Answer: Conifers. A variety of conifers thrive in the taiga where they easily shed snow while keeping their needles all winter. The small needles of the conifers, which include black spruce, white spruce, balsam fir and jack pine, feature a waxy coating that helps minimize the loss of moisture.

Explanation:

8 0
2 years ago
According to the __________, a species is a group of populations whose members have the potential to interbreed in nature and pr
Sauron [17]

Answer:

biological species concept

Explanation:

The biological species concept is the most commonly used and acceptable definition of species, which explains that a group of organisms can be referred to a species if members of the group can interbreed successfully to produce viable offspring that are also fertile. It explains that there tend to be reproduction barriers that would prevent different species of organism from successfully interbreeding. Also, that two organisms have the same appearance, do not necessarily mean they belong to the same species. For example, a horse and a donkey were interbreed to produce an offspring called the mule, but, the mule was found to be infertile. A horse and a donkey are different species, even though they have close appearance.

6 0
3 years ago
What is this? Please answer with an explanation and if you get this right I'll give you a like and a 5 star
LekaFEV [45]

Answer:

its C

Explanation:

i do AP bio so this is something learned a long time ago also im a straight A student so yeah

4 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Which of the following is the largest biome on earth?
AURORKA [14]

Answer:

taiga

Explanation:

taiga which is also known as coniferous or boreal forest . Also it is the largest terrestrial biome on the earth

4 0
3 years ago
Other questions:
  • In transcription how does the enzyme know where to start and stop
    7·1 answer
  • What are two likely effects of this parasitism?
    13·1 answer
  • Most living organisms use oxygen to make ATP from glucose.<br><br><br><br> True <br><br> False
    14·1 answer
  • Which of the following statements best describes what happens during the S phase of the cell cycle?
    7·1 answer
  • What step of the carbon cycle is occurring when a plant absorbs carbon dioxide for photosynthesis?
    6·2 answers
  • Which part of cellular respiration uses 2 ATP and produces 4 ATP per glucose molecule?
    10·1 answer
  • Is this statement true or false?
    13·2 answers
  • Which symbol is used to label a male that expresses a sex-linked disorder on a pedigree? An empty circle. A half-filled circle.
    15·2 answers
  • What is a Example of Newton 1st Law and how does it show inertia
    5·1 answer
  • Which is larger - a water molecule or a sugar<br> molecule?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!