1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mina [271]
3 years ago
5

Which is an environmental factor that would MOST LIKELY have an adverse impact on the stability of an ecosystem?

Biology
1 answer:
mr Goodwill [35]3 years ago
8 0
First! Ask yourself... who, what, when, where
You might be interested in
Cellular Respiration requires the use of __________ which are located on the _________.
s344n2d4d5 [400]
Enzymes and cytoplasm A)))
4 0
3 years ago
Can someone please help find the definitions to my biology vocabulary!!
Ann [662]
Codominance - <span>A form of dominance in which the alleles of a gene pair in a heterozygote are fully expressed thereby resulting in offspring with a phenotype that is neither dominant nor recessive.

</span>Mutation<span> occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene.</span>
7 0
4 years ago
Explain the interaction with another body system.
RUDIKE [14]

Answer:

Body systems are used throughout your body to help you move and to live like the heart for example.

8 0
3 years ago
What wave can travel through space without a medium
Nata [24]

Answer: Electromagnetic waves

Explanation: The main property of the waves is the way how they propagate or travel in medium The waves which can travel without a medium is said to travel in vacuum or air.

8 0
3 years ago
The macromolecule that carries that code for building our body?
a_sh-v [17]
Nucleic acid is the macromolecule that carries code for building our body. 
3 0
4 years ago
Other questions:
  • Where in the neuron is an action potential initially generated?
    14·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Organisms maintain dynamic homeostasis through behavioral and physiological mechanisms. in your own words, give an accurate expl
    12·1 answer
  • Which organelle fills the cell, holds organelles, and is the place for most of the metabolic activity in the cell occur?
    11·2 answers
  • How does temperature change always move from regions of hot to regions of cold?
    8·2 answers
  • Where do you think the most chloroplasts are found in the plant system—in leaves, the stem, or the root?
    11·1 answer
  • Match each stem or root to its description.<br>Plz help meeee<br>WILL MARK BRANLYIEST ​
    5·2 answers
  • B) Give an example of an animal with radial symmetry and an example of an animal with bilateral
    5·1 answer
  • What is the phenotype for females
    10·2 answers
  • Are there any parts of the human body that get oxygen directly from the air and not from the blood?​
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!