1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NikAS [45]
2 years ago
8

Which of the following cause the ventricles to contract?

Biology
1 answer:
vovikov84 [41]2 years ago
6 0

Answer:

D. All of the above

Explanation:

In Human anatomy, cardiac cycle can be defined as a complete heartbeat of the human heart which comprises of sequential alternating contraction and relaxation of the atria and ventricles, therefore causing blood to flow unidirectionally (one direction) throughout the human body.

Generally, the cardiac cycle occurs in two (2) stages;

1. Diastole : in this stage, the ventricles is relaxed and would be filled with blood.

2. Systole: at this stage, the muscles contracts and thus, allow blood to be pushed through the atria.

Cardiac output can be defined as the volume of blood that is being pumped by the mammalian heart through the left and right ventricle per unit time (minute).

The following conducting systems of the heart cause the ventricles to contract;

I. Atrioventricular (AV) node: it's a component of the electrical conduction system of the mammalian heart located in the Koch triangle which connect the ventricles and atria electrically.

II. Atrioventricular (AV) bundle: it's a specialized tissue that transmits electrical impulse from the atrioventricular (AV) node to the Purkinje fibres of the ventricles.

III. Purkinje fibers: it's a network of specialized cells that comprises of glycogen and they transmit cardiac action potentials in a rapid manner from the atrioventricular (AV) bundle to the myocardium of the ventricles.

Furthermore, the right atrioventricular valve (AV) also referred to as the tricuspid valve is located on the right dorsal side of the human heart. The right atrioventricular valve (AV) comprises of three (3) leaflets (flaps) which opens and closes in order to allow for the flow of blood from the right atrium of the human heart to the right ventricle. Also, the right atrioventricular valve is saddled with the responsibility of preventing blood from flowing backward in the mammalian heart.

You might be interested in
The process of the Rock Cycle
Anna007 [38]
I would say d, based on the fact matter cannot be created nor destroyed
3 0
3 years ago
Read 2 more answers
What kind of bond exists between two amino acid in polypeptide
Gnoma [55]
Two amino acids form a peptide bond together as these are just proteins.
5 0
2 years ago
Read 2 more answers
How long does carbon dioxide stay in a plant cell?
Zielflug [23.3K]
Is about 3 hours to my understanding
6 0
2 years ago
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
An animal traveling at 3mm/h east increased his velocity to 5 mm/h east in one hour. What was the animal’s acceleration?
Degger [83]

Answer:

An animal traveling at 3mm/h east increased his velocity to 5 mm/h east in one hour. What was the animal’s acceleration?

Acceleration= velocity/time

velocity=5mm= 0.005m

time= 1 hour= 60 seconds

A= 0.005/60

Acceleration= 0.000083m/s square

Explanation:

6 0
3 years ago
Other questions:
  • Which receives more isolation: Mars or Saturn?
    14·1 answer
  • What term describes the way an organism responds to stimuli?
    15·2 answers
  • Is the formation of fat a dehydration synthesis?
    5·1 answer
  • Waxy endosperm (wx), shrunken endosperm (sh), and yellow seedling (v) are encoded by three recessive genes in corn that are link
    9·1 answer
  • Salt is an ionic compound. It _____.
    13·2 answers
  • Which of the following best describes the function of nasal hair? Group of answer choices
    7·1 answer
  • Which scientists was the first to suggest that growth of cancerous cells was a result of abnormal chromosomes?
    14·1 answer
  • What would happen to the heart rate if CO2, a toxin, was building up in the blood due to increased rates of aerobic respiration?
    11·2 answers
  • Which correctly list three places that freshwater is found?
    6·2 answers
  • Pancreatic amylase is a digestive enzyme that digests starch in the small intestine. pancreatic amylase's optimum pH is slightly
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!