1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maw [93]
2 years ago
12

Describe the channels and ions that neurons use to generate an action potential. (include when channels open and close and which

way ions move)
Biology
1 answer:
IgorC [24]2 years ago
4 0

Answer:

Both of the cells make use of the cell membrane to regulate ion movement ... So another way that channels can be categorized is on the basis of how they are gated. ... When the cell is at rest, and the ion channels are closed (except for leakage ... What has been described here is the action potential, which is presented as a

You might be interested in
He finally broke the spell of Boston and his words what two things are being compared in the metaphor used here? why?​
Mumz [18]

Answer:

Guilt, self disgust, senslessness

Explanation:

Boston is plagued by feelings of guilt and self-disgust after the senseless, cold-blooded murder of Gumboot Dhlamini. He wants to know if Tsotsi shares these feelings. Boston asks Tsotsi many questions and this has a profound effect on Tsotsi, who does not remember much of his past.

7 0
2 years ago
Fungus-like protists are autotrophs that absorb nutrients from dead or decaying organic matter.
iVinArrow [24]
If you are asking if that is true or false, it is false because all fungus like protists are heterotrophs, not autotrophs
8 0
3 years ago
Even without being exposed to sunlight, humans exhibit a wide range of skin colors due to differences in the abundance of melano
ivann1987 [24]

Answer:

The stuff that comes from th light and hits you skin which triggers reactions:(

Explanation:

I'm just kidding i have no clue only in 8th grade but i haven't gone over it in class

8 0
3 years ago
Pleaseeeee helpppp
Alex73 [517]
The answer is C Good luck
6 0
2 years ago
Read 2 more answers
DNA is made up of:<br><br> Please help thank you
REY [17]
2 chains and 4 nucleotides
7 0
3 years ago
Other questions:
  • According to the food web which organism is an herbivore?
    11·2 answers
  • Consider the diagram of the Earth, Sun, and Moon system. Which phenomenon is MOST DIRECTLY caused by the revolution of the Earth
    9·2 answers
  • What are the polymers of nucleic acids called
    13·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Definition! Help please!! I give brainliast please help meeee
    9·2 answers
  • Consumer surplus is the area
    12·2 answers
  • Animal use chlorophyll to produce glucose.<br> True <br> False
    15·2 answers
  • Cellular respiration converts the energy of fuel molecules to a form of energy that a cell can use to perform work. In an averag
    10·1 answer
  • You are a forensic scientist about to enter one of two parallel universes: in one, you will be unable to use physics in any of y
    14·2 answers
  • Drag the tiles to the boxes to form correct pairs.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!