1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astraxan [27]
3 years ago
9

What are the reactants necessary for photosynthesis?

Biology
1 answer:
Shtirlitz [24]3 years ago
6 0

Answer:

Water, Carbon Dioxide, and Sunlight

Explanation:

After the process is complete, photosynthesis releases oxygen and produces carbohydrate molecules, most commonly glucose. These sugar molecules contain the energy that living things need to survive.

You might be interested in
Why are viruses like the avian flu important for vet scientists to study?
ValentinkaMS [17]

Answer:

Therefore, a global zoonotic disease surveillance system to reduce the emergence of zoonotic diseases in humans and to help detect other livestock diseases early could help to prevent the staggering economic losses associated with zoonotic disease outbreaks. So, yes I would say that they are very important to study.

Explanation:

5 0
3 years ago
Read 2 more answers
What human activities affect the water, carbon, and the nitrogen cycle what are the consequences
Mademuasel [1]
The nitrogen cycle is impacted by humanswhenever fertilizer is applied to farmland to help crops grow. This adds nitrates to the soil. If soil erodes, the nitrates are transported and deposited in the nearest body of water. This can cause algae to overgrow in a process called eutrophication. The lake will run out of oxygen as the algae die off and bacteria begin their decomposition.Sessile organisms are greatly affected. 
8 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Accidental post oops.
LuckyWell [14K]

Answer:

SORRYΩ

Explanation:

SORRYΩ

7 0
3 years ago
Troy heads a large-scale farm that specializes in cattle. Which title best describes Troy’s position?
Margaret [11]

Answer:

farm hand

Explanation:

because the farm only specializes in cattle

5 0
3 years ago
Other questions:
  • The school has 800 students with 20 students on the gymnastic team and 10 students on the chess team (including 3 students who a
    13·2 answers
  • The vascular bundles in both monocots and dicots contain A. xylem. B. phloem. C. cambium cells. D. cork cells.
    5·1 answer
  • What happens to your pulse when you run
    13·2 answers
  • Write a complete sentence for the word Germinal period <br><br> Please help !!!
    12·2 answers
  • Select the correct answer.
    8·1 answer
  • How were Redi’s and Pasteur’s experiments different?
    7·1 answer
  • Which of the following is involved in the opening of stomata for the gas exchange of the plant?
    5·1 answer
  • The carbon cycle is a cycle among the carbon reservoirs.What is a carbon reservoir and what are some examples?
    13·2 answers
  • Cells have different membrane carbohydrates if they do different
    12·1 answer
  • Too much logging in the oyamel fir forests could lead to the eastern monarch butterfly going extinct because _______. a. the ent
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!