1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tom [10]
3 years ago
15

By the 1950s, there was Choose... major variety(ies) of banana being grown commercially in the world. Then, a soil fungus called

Fusarium struck the banana plants, causing Panama Disease. Because of Choose... , the bananas could not resist the fungus. Within a few years, the entire commercial banana industry had collapsed. The industry switched to a different kind of banana. Yet fifty years later, Panama Disease has returned, and there is still no cure for it. Scientists argue that the best solution for the future is Choose... .
Biology
1 answer:
koban [17]3 years ago
4 0

Answer:

Produce resistance variety or use of fungicides.

Explanation:

The best solution for the future is to produce resistance variety to Panama Disease or fungicide spray that kills Fusarium fungus that causes Panama Disease. If the variety is resistance against Fusarium fungus so they get no adverse affect from it. The use of chemical that kills Fusarium fungus is also a good method to protect banana industry from the adverse effect of this disease.

You might be interested in
DE QUE MANERA SE FORMO LA LUNA
BaLLatris [955]
Búscalo, Wikipedia es bien!!!
6 0
3 years ago
Glucose,fructose,and sucrose are all carbohydrates. what elements make up all carbohydrates?
PolarNik [594]
All carbohydrates are made up of carbon, oxygen, and hydrogen.

The chemical formula for Glucose is C_{6}  H_{12}  O_{6} .
The chemical formula for Fructose is the same as that of Glucose. The difference between the two is how they are structured.
The chemical formula for Sucrose is C_{12} H_{22}  O_{11} .

As you can see in the chemical formulas of Glucose, Fructose, and Sucrose, they are all made up of the elements carbon, hydrogen, and oxygen.
5 0
4 years ago
Read 2 more answers
If green seed color is dominant to yellow seed color, if two yellow seeded plants produce offspring, what percent will be green?
natta225 [31]

Answer: Their will be a 50/50 chance it would be green

Explanation:

6 0
3 years ago
Read 2 more answers
A gardener is installing several large flower beds. The flower beds will vary in length from 5 to 12 feet. Depending on the type
dezoksy [38]

The gardener should address the measurements he needs to make so that planting information is clear, and that the roots are spaced to grow.

<h3>How to calculate amount of landscaping plants?</h3>

 just divide the area of the bed by the area occupied by the seedling and we will have the total amount of seedlings to be used. In this way, we also understand that the area occupied by the seedling is equal to the spacing between seedlings raised to the square.

<h3>How to calculate the spacing between plants?</h3>

If we plant with a spacing of 0.60 meters, the number of seeds per meter will be calculated as follows: Being 1 hectare = 10,000 square meters and the spacing between rows of 0.60 m, we have the equivalent of a range of 0, 60 meters by 16,667 linear meters (10,000 divided by 0.60).

With this information, we can conclude that the area occupied by the seedling is equal to the spacing between seedlings raised to the square.

Learn more about seedlings in brainly.com/question/14852087

#SPJ1

8 0
1 year ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Other questions:
  • Chemical reactions are result of an atom attempting
    11·2 answers
  • What type of molecule serves as the inorganic carbon reservoir for photosynthesis?
    9·2 answers
  • PLEASE HELP
    10·2 answers
  • The primary cardiac marker which is the most recommended by the AHA and known to be the most specific to indicate a potential MI
    12·1 answer
  • Describe two ways in which animals must maintain homeostasis
    15·1 answer
  • 9. How might an intense solar storm affect people on Earth?
    15·1 answer
  • The force driving simple diffusion is _____, while the energy source for active transport is _____.
    5·2 answers
  • 1.) What Is The Model Of (Terens Rutherdford)<br>Paki help <br>God Blees!​
    9·1 answer
  • HELP ME PLEASE SOMEONE :(
    6·2 answers
  • Imagine that a newly discovered, recessively inherited disease is expressed only in individuals with type O blood, although the
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!