Búscalo, Wikipedia es bien!!!
All carbohydrates are made up of carbon, oxygen, and hydrogen.
The chemical formula for Glucose is

.
The chemical formula for Fructose is the same as that of Glucose. The difference between the two is how they are structured.
The chemical formula for Sucrose is

.
As you can see in the chemical formulas of Glucose, Fructose, and Sucrose, they are all made up of the elements carbon, hydrogen, and oxygen.
Answer: Their will be a 50/50 chance it would be green
Explanation:
The gardener should address the measurements he needs to make so that planting information is clear, and that the roots are spaced to grow.
<h3>How to calculate amount of landscaping plants?</h3>
just divide the area of the bed by the area occupied by the seedling and we will have the total amount of seedlings to be used. In this way, we also understand that the area occupied by the seedling is equal to the spacing between seedlings raised to the square.
<h3>How to calculate the spacing between plants?</h3>
If we plant with a spacing of 0.60 meters, the number of seeds per meter will be calculated as follows: Being 1 hectare = 10,000 square meters and the spacing between rows of 0.60 m, we have the equivalent of a range of 0, 60 meters by 16,667 linear meters (10,000 divided by 0.60).
With this information, we can conclude that the area occupied by the seedling is equal to the spacing between seedlings raised to the square.
Learn more about seedlings in brainly.com/question/14852087
#SPJ1
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved