1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svlad2 [7]
3 years ago
11

When homologous chromosomes cross over, what occurs?

Biology
2 answers:
Nostrana [21]3 years ago
6 0

Answer:

this happens between prophase I and metaphase I

Explanation:

PIT_PIT [208]3 years ago
6 0

Explanation:

during crossing over , homologous chromosomes come together in order to form a tetrad . This close contact allows the nonsister chromatids from homologous chromosomes to attach to one another and exchange nucleotide sequences.

You might be interested in
Circle the letters of each structure that plant cells contain
Alik [6]

Answer:

<h2>B. ER</h2>

Explanation:

  • is just my opinion
  • but hope it helps you
4 0
2 years ago
Read 2 more answers
Which of the following statements is true?
Fiesta28 [93]
The correct option is B.
Carrot can be described as a ground tissues because it is formed inside the ground in form of tap root. The remaining options are incorrect for the following reasons:
1. Animals can not make their own food because they do not have chloroplast not because they do not have vacuoles.
2. The main function of dermal tissue is protection from water loss not photosynthesis. 
3. The cerebellum controls balance and coordination not cerebrum.
4 0
4 years ago
Read 2 more answers
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
Some ocean plants, such as photosynthetic algae, benefit when dissolved CO2 levels in ocean water are elevated. Complete the
Aleksandr [31]

Answer:

CO2 + H2O ---SUNLIGHT--------> C6H12O6 + O2

Explanation:

In the process of photosynthesis, carbondioxide reacts with water molecules in the presence of sunlight forming glucose molecules and oxygen gas. The carbondioxide enters the plant body through small openings called stomata, these stomata opens when there is sunlight whereas water enters the plant body through roots from the soil and reaches to the leaves. In leaves both combine produces glucose which can be stored in different parts of the body and some oxygen is used by the plants in the process of respiration and extra is released through stomata.

8 0
3 years ago
Examine the following scenario: A population of small fish lives in a lake (Lake A).The dark-colored fish are the ancestral phen
Alinara [238K]
I believe it is C. since Natural selection is when a specific group isn't able to pass it's alleles down to the next generation and they dominated by a new species, but in this case the fish migrated to another lake they are able to pass down their alleles.

Forgive me of am wrong
6 0
4 years ago
Other questions:
  • Many animals travel in packs or herds to increase chance of survival. This type of adaptation would be classified as a... 1) str
    9·1 answer
  • How is the speed of a rivers flow determined??????
    5·1 answer
  • The amount of water vapor in the air at any one time depends on
    11·1 answer
  • If an allele is fixed in a gene pool, then all individuals in the population are homozygous for that allele. True False
    11·1 answer
  • You strip off all proteins on the cell surface by using a protease (an enzyme that destroys proteins). Now, when you add a speci
    15·1 answer
  • During the Mesozoic period, diapsids diverged into_______.
    10·1 answer
  • Plz answer my question i asked before this (plz, i will give brainliest to u if answered correctly)
    15·1 answer
  • Based on your work with lab specimens and the information available on pages 93-97 of your lab manual, which of the following ch
    12·1 answer
  • What are three adaptations and their functions?
    7·1 answer
  • If mitosis stopped in your body, what effects would you see most rapidly? Which tissues would
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!