1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oduvanchick [21]
3 years ago
7

As you watch the animations from https://gpm.nasa.gov/education/videos/water-cycle-steaming-air depicting wind and evaporation d

ata over the world, describe what you notice about the patterns the winds and clouds follow: Do clouds and wind appear to follow the same patterns? Can you find any patterns in the direction that they move?
Biology
1 answer:
Novay_Z [31]3 years ago
8 0

Answer:

okie dokie ima ready to run

Explanation:

You might be interested in
Use the drop-down menus to complete each statement.
EleoNora [17]

Answer:

1. Bureau of Land Management

2. US Fish and Wildlife Service

3.US Forest Service

4. Bureau of Land Management

5.National Park Service

Explanation:

4 0
3 years ago
In a particular case of secondary succession, three species of wild grass all invaded a field. By the second season, a single sp
Maru [420]

Answer:

In a particular case of secondary succession, three species of wild grass all invaded a field. By the second season, a single species dominated the field and the other two species had a lower relative abundance. A possible factor contributing to the abundances of these species in this example of secondary succession is <u>inhibition</u>.

Explanation:

Trees are great examples of allelopathy in plants. Some use their allelochemicals to inhibit germination or impede development of nearby plant life. Most allelopathic trees release these chemicals through their leaves, which are toxic once absorbed by other plants. Black walnut is a prime example of this.

8 0
3 years ago
What does the theory of evolution tell us about how organisms adapt to their environment over time?
beks73 [17]

Answer:

a

Explanation:

7 0
3 years ago
Can you help me d d d d d d d dd d dd d dd d d d d
Eduardwww [97]

Answer:

D

Explanation:

It's kind of hard to explain, if it's hot, it's the temperature.

The Answer was in your question. :)

5 0
4 years ago
Read 2 more answers
The binding of a compound to an enzyme is observed to slow down or stop the rate of the reaction catalyzed by the enzyme. Increa
Setler79 [48]

Answer:

The correct answer is A the compound is a competitive inhibitor

Explanation:

Competitive inhibitor competes with the substrate to bind to the active site of the target enzyme and after binding to the active site the inhibitor slow down or stop the reaction catalyzed by that enzyme.

          Competitive inhibitor basically effects the Km value of the enzyme thus decreasing the activity of the later.

           Increasing the substrate concentration displace the inhibitor from the enzyme"s active site thus reducing the inhibitory effects of the later thus increasing the activity of the enzyme.

8 0
3 years ago
Other questions:
  • When the choking victim becomes unconscious cpr should be started without checking the pulse?
    13·2 answers
  • 39 POINTS NEED DONE ASAP!!!!!
    5·1 answer
  • In order to be classified in the same species, a group of organisms must be able to do what?
    13·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • During the translation of mRNA molecules, the new polypeptides are often directed to specific parts of the cell by the presence
    9·1 answer
  • A sample is termed ____ if it has similar characteristics to the population being studied.
    12·2 answers
  • Explain why the fall and spring seasons are referred to as equinoxes.
    7·1 answer
  • Which is best describes a predator animal?
    10·2 answers
  • True/False: The law of conservation of matter applies to the cycle of photosynthesis and cellular respiration.
    13·2 answers
  • Pepsin, a digestive enzyme that degrades proteins in the stomach, is synthesized as pepsinogen and converted to active pepsin in
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!