1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
3 years ago
5

What is the solution to the system of equations graphed below? y = -2x - 3 y = 3x + 2 O A. (-1,1) B. (0,2)​

Mathematics
1 answer:
Grace [21]3 years ago
3 0
Answer:

A. (1-,1)

How ?: Just plug in -1 in the x spot and 1 in the y spot on both sides... If answers are the same that’s the answer.
You might be interested in
N a classroom of 33 students, the ratio of boys to girls is 3 : 8. How many boys are in the class?
tiny-mole [99]

3 boys + 8 girls = 11 students

3 boys/ 11 students = x boys /33 students

using cross products

3 * 33 = x*11

divide by 11

99/11 = x

x=9

There are 9 boys

4 0
3 years ago
12 1/2 gal= qt<br> can you help me plsssssss
Deffense [45]

Answer:

50 qrts

Step-by-step explanation:

12.5 gal = 4x qrts

12.5 * 4 = 50

7 0
3 years ago
Read 2 more answers
51 divided by 4539 answer
Free_Kalibri [48]

Answer:

51/4539=.01123596

4539/51=89

Step-by-step explanation:

6 0
3 years ago
What is the verbal expression for 7 to the third power
ANEK [815]
The verbal expression for 7 to the third power is 343
5 0
3 years ago
Read 2 more answers
Help me please anybody. And I am in my school iPad
Debora [2.8K]

Answer:

(0,5)

Step-by-step explanation:

I'm really not sure but I'm pretty positive that this is the answer if not than my bad

8 0
2 years ago
Other questions:
  • All 3,000 seats in a theater are being replaced so far 5 sections of 136 seats and a sixth section containing 348 seats have bee
    6·1 answer
  • You launch a ball at an angle of 35 degrees above the horizontal with an initial velocity of 38 m/s. What is the time the ball w
    14·1 answer
  • What are the asymptotes of the graph of f(x) ?
    9·1 answer
  • Mr. Gaines is catering his company picnic. He will pay $18.45 for 3 people to eat barbecue lunch. At this rate, how many people
    8·2 answers
  • Ava's aquarium is 10 inches tall 15 inches long and 8 inches wide. the aquarium is 95% filled with water. how many cubic inches
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What measure of positions divides the data into 100?
    6·1 answer
  • Find the area of the figure
    6·1 answer
  • Need help ASAP, will give Brainly!
    11·2 answers
  • How does graphing the solution help you to be sure you have correct solution?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!