1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
anygoal [31]
3 years ago
11

Over the past few hundred years, the human population on Earth has

Biology
1 answer:
Alex_Xolod [135]3 years ago
6 0

Answer:

7.9 billion

in June 2021 to the United nations Estimated elaborted by worldmeter.

You might be interested in
In guinea pigs, the allele for short hair is dominant to long hair. A guinea pig with short hair is crossed to one that has long
Anton [14]

I would choose Option 2

about 50% chance that the dominance is in, but when it is, its dominant, of course.

no other Option can give you a 50% chance

in 1 its always there, in 3 as well, in 4 never

5 0
3 years ago
Read 2 more answers
you are working as a medic at a gymnastics competition, and one of the gymnasts has a bad landing after a vault, injuring her le
Olegator [25]

Answer:

The bone has broken and either severed or blocked the blood vessels

Explanation:

4 0
3 years ago
List the reasons why food chains to not send to exceed 4 links
Hitman42 [59]
As the number of organisms increase so does their tropic levels. As one organism eats the other energy is being transferred to that organism. The larger the food chain the lesser the organism' s would be because they would lose energy while trying to hunt and catch their prey and other activities. The food chain usually ends at the tertiary consumer or the fourth link because if it goes on like that there would be less energy hence these organisms would most likely starve and gradually die.
4 0
3 years ago
Witch steps are important when designing and conducting a scientific experiment
enot [183]
The scientific method :)

8 0
3 years ago
Help please someone please
skelet666 [1.2K]

Answer:

mhkhku

Explanation:

bmvgf.  

8 0
3 years ago
Other questions:
  • How does the location of nodules relate to the function of the nodule? Explain.
    6·1 answer
  • Which is not a true statement about goals? Choose all that apply.
    7·2 answers
  • HELPPPP!!!! Changes in ecosystems can be attributed to natural causes, such as natural disasters, seasonal variations
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • "Which of the following statements are true?
    15·2 answers
  • if you have a bucket of water and you swung it in a upside down circular motion and no water fell out. what causes that to happe
    13·1 answer
  • Chloroplasts require oxygen.<br> True<br> Or<br> False??
    9·1 answer
  • GIVING 15 POINTS AND BRAINLIEST!!!!!!! How does DNA affect your genetic traits?
    14·1 answer
  • Sea nettles are a type of jellyfish found in Chesapeake Bay. They eat comb jellies. Comb jellies eat oyster
    6·1 answer
  • Which forms as a result of compressional stress?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!