1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Black_prince [1.1K]
3 years ago
11

Which scenario below best shows how state taxes support the economy?

Law
2 answers:
Sergio039 [100]3 years ago
4 0

Answer:

A special one year tax pays for building new schools.

A special one-year tax to help pay for building new schools would serve as an example of how local taxes support the economy. Public school funding is usually based on local taxes and therefore, this example is most likely exemplary of this.  

<u><em>Please mark as brainliest if answer is right</em></u>  

Have a great day, be safe and healthy  

Thank u  

XD  

Thepotemich [5.8K]3 years ago
4 0
The correct answer is C) a special one year tax pays for building new schools. The scenario that best shows how local taxes support the economy is "a special one year tax pays for building new schools." Local taxes support the economy because they often pay for road repair, firefighters, police officers
You might be interested in
If you were a police chief and an officer in your department routinely violated the knock-and-announce requirement while executi
baherus [9]

Answer:

Personally I would as it can cause legal problems

Explanation:

7 0
4 years ago
Read 2 more answers
Can you pls help to number 1 23 thank you :)
fenix001 [56]

Answer:

1-a scientific theory is an in-depth explanation of the observed phenomenon. A law is a statement about an observed phenomenon or a unifying concept.

2-substantiated, explanatory, predictive, and testable

3-It is a misconception that theories turn into laws with enough research

Explanation:

3 0
3 years ago
Read 2 more answers
What are the three arguments concerning the Integration angle in Affirmative Action? (Name all three and explain)
snow_tiger [21]

Answer Integration angle just means peoples perspective on integration!

Explanation:

I had a little trouble reading this so I apologize if it's not correct!

Try rewording the question as: What are 3 arguments people make against integration when it comes to affirmative action?

I sadly do not know the 3 arguments regarding integration in affirmative action, but I hope the way I reworded the question helps! The term "integration angle" is rather confusing.

7 0
3 years ago
What is the basic principle of equality can be check or what is the basic principle of equality ​
Yakvenalex [24]

Answer:

The constitutional principle of equality requires that equal treatment be applied to equal situations.

Explanation:

7 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Who is Prime Minister of world ​
    8·1 answer
  • Define the following terms:
    5·2 answers
  • Robert very much wants to hire Jacqueline because she is African American and Beck ‘n’ Call does not have a large enough number
    6·1 answer
  • There seems to be to much standerized testing in public schools fact opion explain
    13·2 answers
  • What are four kinds of assistance Missouri gives to voters who need it? <br> -am. Gov.
    15·1 answer
  • How should<br>we utilize our<br>rights?​
    14·1 answer
  • A homeowner filed a federal diversity action against the manufacturer of a pressure cooker for a products liability action based
    14·1 answer
  • Civic virtue is also known as what?
    15·1 answer
  • What is the Top 10 deadliest animals in the world. Please Help Please
    13·1 answer
  • Please helpppp! Forensic science FLVS
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!