1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kiruha [24]
3 years ago
5

How is hydrogen bonding responsible for the heat capacity of water?

Biology
1 answer:
Anika [276]3 years ago
5 0
Water's high heat capacity is a property caused by hydrogen bonding among water molecules. When heat is absorbed, hydrogen bonds are broken and water molecules can move freely. When the temperature of water decreases, the hydrogen bonds are formed and release a considerable amount of energy
You might be interested in
You are attempting to see if a suspect is associated with a crime. The only evidence you have is a tiny drop of blood from the c
kykrilka [37]

Answer:

There are no options in this question but generally a sample of DNA can be increased;

By using Polymerase Chain Reaction (PCR) technique.

Explanation:

This question describes the application of making molecular biology to solving a crime problem; a branch called forensics. In this case where an insufficient small amount of DNA sample was recovered from the blood in a crime scene, the polymerase chain reaction technique, commonly known as PCR can be used to increase the DNA sample.

In the 1980's, a molecular technique used to amplify part of a template DNA strand to produce several copies of it, was invented by Kary Mullis and his colleagues. This amplification refers to the numerical increase in the number of DNA sequence.

6 0
3 years ago
Protista are
Shkiper50 [21]
Protista is <span>very </span>diverse kingdom,. It includes a wide range of organisms that are not particularly related. The members<span> of the protista kingdom are called </span>protists. They are not <span>animals, </span>plants or fungus.
<span>|Protista are reclassified as scientists learn more about their diversity.
Correct answer: C</span>
7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
This is the last part of the cell cycle. This is process in which the cytoplasm is divided between the two new daughter cells.
never [62]
This process is called Cytokineses.
5 0
3 years ago
Read 2 more answers
Fears of radiation exposure from normal use of such detectors are largely unfounded. identify reasons why 241am smoke detectors
maxonik [38]
The reasons why  241am smoke detectors are perfectly safe is because;
(i)   The amount of americium is very little.
(ii)   The aluminium core is where the detector is hosted.
(iii)  The detector has a plastic cover.
(iv)   Radiation is limited in penetrating power.
(v)    There is a low number which is leaving the case.
(iv) ions get trapped by electrodes.
7 0
3 years ago
Other questions:
  • Which molecule is produced by adding two electrons and one proton to NADP+?
    6·2 answers
  • Name at least 1 renewable form of energy that can be added to a home to make it more energy efficient.
    6·2 answers
  • . Which of the following is NOT a soil texture? A. Sand B. Clay C. Smooth D. Silt​
    8·2 answers
  • Following repolarization, the neuron may become slightly hyperpolarized before it re-establishes its resting membrane potential.
    11·1 answer
  • Is the is the movement of planets predictable
    5·1 answer
  • What are the characteristics of a multi celled organism
    13·1 answer
  • Are the anomalies the same thickness along all ridge segments Why or why not?<br> plz help :D
    11·1 answer
  • If an organism's gametes contain 25 chromosomes, how many chromosomes will their somatic (body cells) contain?
    9·1 answer
  • Plant cells make protein
    11·2 answers
  • On a piece of paper, or using the pointer draw in word, draw 6-10 water molecules in the arrangement they would take when water
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!