Describe the lithosphere and its role in plate tectonics.

Biology

2 answers:

Vlada [557]3 years ago

8 0

Answer:

it is the crust, and everything grows on it. they move around constantly at an incredibly slow pace, and float in the mantle. the mantle causes them to move around sometimes to cause earthquakes, by pulling them apart or pushing them together to make canyons and mountains respectively.

Explanation:

Bas_tet [7]3 years ago

6 0

The lithosphere,which is the rigid outermost shell of the planet(the crust,and upper mantle),is broken into tectonic plates.The earth's lithosphere is composed of seven or eight major plates(depending on how they are defined)and many minor plates.In this way,the total surface of the lithosphere remain,the same.

You might be interested in

1. DIRECTIONS: The questions in this segment consist of two

BARSIC [14]

Answer:

Ce clasă ești sa văd daca te pot ajuta?

7 0

3 years ago

1. There are 200 bones in the human body. 2. The skeleton is the structural arrangement of bones in the human body. 3. A bones a

Andrews [41]

Answer:

Salmat po

Explanation:

sorry i can send the answer he said "We dont use rude word here, please change"

6 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Chemical transmitters can stimulate any receptor site to initiate an action.

dimaraw [331]

Not true, certain chemical transmitters stimulate certain receptors

4 0

3 years ago

Kendra is studying the energy pyramid shown. Which statement is supported by the energy pyramid?

Nana76 [90]

Answer:

A. The ecosystem can support fewer foxes than grasshoppers.

Explanation:

Since the energy has to transfer from organism to organism, it reduces in amount. Since there are more grasshoppers than foxes, than the ecosystem can support grasshoppers easily.

4 0

3 years ago