Answer:
Ce clasă ești sa văd daca te pot ajuta?
Answer:
Salmat po
Explanation:
sorry i can send the answer he said "We dont use rude word here, please change"
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Not true, certain chemical transmitters stimulate certain receptors
Answer:
A. The ecosystem can support fewer foxes than grasshoppers.
Explanation:
Since the energy has to transfer from organism to organism, it reduces in amount. Since there are more grasshoppers than foxes, than the ecosystem can support grasshoppers easily.