1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rama09 [41]
2 years ago
5

How do fossils validate the existence of a global flood

Biology
1 answer:
Georgia [21]2 years ago
3 0

Answer:

This concept is called the theory of plate tectonics.

Explanation:

You might be interested in
A mother with type A blood and genotype IAi and a father with blood type B and genotype IBi have children who grow up and become
777dan777 [17]
Hi

I am new here

But I think the answer is IAIB
6 0
3 years ago
Compare the sugar-phosphate arrangement in the backbone of the DNA from the plant, the manmal and the bacterium. Are there any d
eimsori [14]

Answer:

No, there are no differences

Explanation:

Deoxyribonucleic acid (DNA) is a molecule composed of two polynucleotide chains that interact together in order to form a double helix. This molecule (DNA) carries the genetic instructions that make each species unique. In DNA, each polynucleotide chain is composed of nucleotide monomers: a nucleotide is composed of a deoxyribose sugar attached to a phosphate group and one nitrogen-containing base (i.e., adenine, thymine, guanine and cytosine). This basic structure is the same among different species, and, therefore, genetic differences between different groups (in this case, animals, plants, and bacteria) are caused by differences in the nucleotide-base sequences of their DNA molecules.

4 0
2 years ago
Mercury has the largest eccentricity of any of the eight planets. What is Mercury’s orbital eccentricity?
vladimir1956 [14]

Answer: 0.206

Explanation:

pretty much near 0.2056 if you round the 5 to the 6

7 0
2 years ago
Read 2 more answers
Whats the worst Zodiac sign and why?<br>Whats your Zodiac sign? <br>have a nice day ♡​​
mixas84 [53]

The rat. I don't know if you meant zodiac ANIMAL or astrology sign like aquaris for example. however the rat zodiac animal is defined as the weakest of all the zodiac animals.

Have a Merry Christmas,

Miri

3 0
2 years ago
Read 2 more answers
Hurry please I am on a quiz and hello
kirza4 [7]

Explanation:

vascular because it has spores

vascular because it has true roots

nonvascular because it has spores

nonvascular because it has true roots

5 0
2 years ago
Other questions:
  • Describe three (3) common fungal respiratory infections and the name of the specific organism that causes them as well as some s
    11·1 answer
  • Which of the following statements is true?
    11·2 answers
  • which three types of cells are part of ground tissue storing food conducting photosynthesis and provinding support
    15·1 answer
  • When animals eat, the food is stored and digested in the stomach or a similar structure. But when a unicellular organism like th
    9·2 answers
  • Directions: Below are a set of scenarios you may encounter during as
    7·2 answers
  • Beriberi is caused by a deficiency of thiamine in the diet.
    9·1 answer
  • What is one of the main functions of the nucleus of an animal cell? It is the place where energy is produced for the animal. It
    14·1 answer
  • _____, the large maggots move away from the body, sometimes into the soil.
    14·1 answer
  • Base your answer to the question on the information below and on your knowledge of biology.
    6·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!