1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masja [62]
3 years ago
15

34. Which system supports the body and protects organs?

Biology
1 answer:
Illusion [34]3 years ago
7 0

Answer:

Explanation:

The skeletal system

The skeletal system works as a support structure for your body. It gives the body its shape, allowing  movement.

You might be interested in
What are the effects of tidal forces
bija089 [108]
High water floods &- volcanic eruptions
4 0
3 years ago
Briefly explain transcription and translation using the following terms: gene, RNA polymerase, tRNA, mRNA, ribosome, nucleus, co
-BARSIC- [3]

Answer:

take the information in DNA and use it to produce proteins. Transcription uses a strand of DNA as a template to build a molecule called RNA. ... During translation, the RNA molecule created in the transcription process delivers information from the DNA to the protein-building machines

Explanation:

which translates mRNA. tRNA is the link between the two other types of RNA.

3 0
3 years ago
A ---- is a multi-level network of feeding interactions, through which
SpyIntel [72]

Answer:

1. Food web

<em><u>HOPE</u></em><em><u> </u></em><em><u>IT</u></em><em><u> </u></em><em><u>HELP</u></em><em><u> </u></em><em><u>YOU</u></em><em><u> </u></em>

<em><u>THANKS</u></em><em><u> </u></em><em><u>FOR</u></em><em><u> </u></em><em><u>POINTS</u></em>

3 0
3 years ago
In which two places do divergent boundaries occur? land and oceans oceans and volcanoes volcanoes and lower mantle lower mantle
strojnjashka [21]

Answer: The answer is A: land and oceans.

i just did the quiz and got it right

hope this helps you :D

6 0
3 years ago
Read 2 more answers
Which sequence furthers scientific knowledge? Hypotheses generate a scientific question, leading to observations, which can be t
Greeley [361]

Answer:

The correct answer is - Observations generate a scientific question, leading to a hypothesis, which can be tested through an experiment.

Explanation:

In any scientific knowledge development process, scientists need to follow the scientific process in a particular sequence that helps in developing and testing a hypothesis.

The sequence has:

observation: Observation requires you to pay attention to occurrences around

Forming question: on the basis of observation form a question about why that occurrence happens.

Hypothesis formation: The hypothesis is your initial prediction on why that happens.

Experiment: The experiment is being done in order to collect data and analysis so you can test your hypothesis

9 0
3 years ago
Read 2 more answers
Other questions:
  • What are the skin layers from inside and outside of your body
    11·1 answer
  • Th formation of new organisms is called
    15·1 answer
  • Which type of rock forms when molten material cools and hardens inside Earth? an igneous rock an extrusive rock a rock with fine
    8·2 answers
  • Why do conservationists sometimes purposely set a forest fire?
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Do all changes to dna alter the phenotype of an organism? Explain.
    14·1 answer
  • WILL GIVE BRAINLIEST!!!!!!
    10·1 answer
  • 1 point
    9·1 answer
  • Why do we need the cell cycle?
    15·1 answer
  • How can meristematic tissue help in the growth in plants?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!