1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
3 years ago
15

According to the table below, how likely is it that blue eyes will show up in the offspring from these parents?

Biology
1 answer:
user100 [1]3 years ago
5 0

Answer:

25 percent.

Explanation:

The mom and dad mostly have the dominant gene E which is green but the dad has one e which is blue so I believe there is a 25 percent chance the child will have blue eyes.

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Electromagnetic waves differ in
nlexa [21]
I think the answer is b. wavelength (:
4 0
3 years ago
Complete the sentence using the correct term.
Maksim231197 [3]

Answer:

Cloning technology

Explanation:

With cloning technology we can replicate and combine different genes to study, save lives, and create new species

3 0
3 years ago
When chromosomes do not separate you end up with a
dusya [7]

Answer:

The phenomenon of unequal separation in meiosis is called nondisjunction. If nondisjunction causes a missing chromosome in a haploid gamete, the diploid zygote it forms with another gamete will contain only one copy of that chromosome from the other parent, a condition known as monosomy. I think sorry if wrong ;)

7 0
3 years ago
In peas, the color yellow (Y) is dominant to the color green (y). How many of the four possible outcomes are yellow?
pantera1 [17]
It depends on the situations. In the first situation, a Yy gene crosses with a Yy gene. 3 out of 4 of the outcomes have a capital Y in them, meaning that they have a dominant yellow allele. The bottom-right box has two lower-case y's, so it will be green. In the second situation, a YY gene crosses with a Yy gene. Here, all 4 out of 4 of the outcomes have at least one capital Y, so they will all be yellow. Hope that helps!

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which process is directly responsible for root growth in plants?
    13·2 answers
  • Organic molecules that catalyze reactions quickly at relatively low body temperatures are called:
    10·1 answer
  • Part A - Access and view the Louisiana Wetlands Loss: Coastal Erosion animation produced by New Orleans Times Picayune. Describe
    6·1 answer
  • Which treatment approach did sigmund freud develop for treating his patients? drug therapy neuropsychology clinical psychology p
    14·1 answer
  • Where did most of the chemical elements that make up our bodies come from?
    9·1 answer
  • Harry is driving on the interstate highway for the first time since he obtained his license. He is nervous and wants to get off
    12·1 answer
  • Why viruses are unable to reproduce on their own
    11·2 answers
  • Question 2
    14·1 answer
  • Removal of nitrates and phosphates
    8·1 answer
  • What does the following equation represent? C6H12O6 + 6O2 → 6CO2 + 6H2O
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!