Answer:
The correct answer is option c. "Tetracycline must be discontinued before beginning the isotretinoin".
Explanation:
Isotretinoin is a medication used to treat cases of severe acne, having dramatic positive effects since the patients start the treatment. However, the use isotretinoin should be monitored by a doctor because it is hard to process and could cause renal side effects. In this case, the patient must discontinue its treatment with tetracycline before start using isotretinoin.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
D
Explanation:
The phosphofructokinase-1 reaction is endergonic.
Respiratory system= breathing system
To keep our Respiratory system healthy we should:
1- never breathe in front of polluted areas
2- never pollute our areas
3- try to make our environment normal
